Incidental Mutation 'R6803:As3mt'
ID533464
Institutional Source Beutler Lab
Gene Symbol As3mt
Ensembl Gene ENSMUSG00000003559
Gene Namearsenic (+3 oxidation state) methyltransferase
Synonyms2310045H08Rik, Cyt19
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6803 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location46707443-46741095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 46709581 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 120 (M120R)
Ref Sequence ENSEMBL: ENSMUSP00000003655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003655]
Predicted Effect probably benign
Transcript: ENSMUST00000003655
AA Change: M120R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000003655
Gene: ENSMUSG00000003559
AA Change: M120R

DomainStartEndE-ValueType
Pfam:Methyltransf_23 34 227 2.5e-14 PFAM
Pfam:PCMT 64 183 7.7e-9 PFAM
Pfam:Ubie_methyltran 64 196 8.9e-16 PFAM
Pfam:PrmA 65 193 1.8e-6 PFAM
Pfam:Methyltransf_31 70 243 2e-36 PFAM
Pfam:Methyltransf_18 71 187 9.7e-14 PFAM
Pfam:Methyltransf_25 75 180 2.8e-15 PFAM
Pfam:Methyltransf_12 76 182 2.9e-14 PFAM
Pfam:Methyltransf_11 76 184 2.7e-19 PFAM
low complexity region 297 310 N/A INTRINSIC
Meta Mutation Damage Score 0.0759 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 94.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AS3MT catalyzes the transfer of a methyl group from S-adenosyl-L-methionine (AdoMet) to trivalent arsenical and may play a role in arsenic metabolism (Lin et al., 2002 [PubMed 11790780]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele have abnormalities in arsenic methylation and in the distribution/retention of orally administered arsenate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg9 A C 9: 50,789,560 D210A probably benign Het
Baz1a T A 12: 54,941,555 S270C probably null Het
Car5a A C 8: 121,923,765 probably null Het
Ccdc187 T A 2: 26,289,779 T223S probably benign Het
Cel T C 2: 28,558,048 N322S probably benign Het
Chd6 T C 2: 160,960,359 E2185G possibly damaging Het
Clcnkb T C 4: 141,405,328 T597A probably benign Het
Cntnap1 A G 11: 101,177,234 Y24C possibly damaging Het
Cog3 A G 14: 75,704,039 S817P probably benign Het
Col8a2 A G 4: 126,312,000 Y601C probably damaging Het
Cpm G T 10: 117,676,097 probably null Het
Cpt2 T C 4: 107,912,664 N79S probably damaging Het
Dnah17 T C 11: 118,125,372 T314A probably benign Het
Dnm1 C A 2: 32,312,754 V46F probably damaging Het
Fat3 C T 9: 15,996,787 V2640M probably damaging Het
Fbxl2 A T 9: 113,984,549 C296S probably damaging Het
Fcgbp A G 7: 28,103,212 T1522A probably benign Het
Foxl2 A C 9: 98,955,932 K91T probably damaging Het
Gm35339 A G 15: 76,356,576 Y488C probably damaging Het
Hdac11 G T 6: 91,166,265 R131L probably damaging Het
Ipo11 T C 13: 106,857,258 I723V probably benign Het
Klhl33 A G 14: 50,896,735 L150P probably damaging Het
Klk1b11 A G 7: 43,997,837 H65R probably damaging Het
Larp7 T C 3: 127,537,036 probably null Het
Ldlrad3 T C 2: 102,113,547 D60G possibly damaging Het
Mlip A T 9: 77,190,381 H177Q probably damaging Het
Mrnip A G 11: 50,199,903 D298G probably benign Het
Npas2 A C 1: 39,336,049 S483R probably benign Het
Nrg3 C A 14: 39,012,000 E310* probably null Het
Olfr1382 T A 11: 49,535,605 L140H probably damaging Het
Olfr504 G T 7: 108,565,413 D127E probably damaging Het
Omg T A 11: 79,502,268 T255S possibly damaging Het
Plekhg6 T C 6: 125,363,663 D578G probably damaging Het
Pygo1 A G 9: 72,942,985 K39E probably damaging Het
Rell2 A G 18: 37,956,941 D66G probably damaging Het
Samd9l A T 6: 3,375,446 I605K probably damaging Het
Sema6d T C 2: 124,664,050 S593P probably damaging Het
Sf3b3 A G 8: 110,825,578 V545A probably benign Het
Speer4f1 T A 5: 17,479,390 probably null Het
Spem1 T C 11: 69,821,148 E230G possibly damaging Het
Sphkap A G 1: 83,280,510 F171L probably damaging Het
Tbc1d13 T C 2: 30,135,510 probably benign Het
Tmem222 A T 4: 133,266,843 N206K probably benign Het
Trnau1ap C T 4: 132,321,770 V41M probably damaging Het
Ttn C T 2: 76,939,043 probably null Het
Ubr3 T C 2: 69,936,024 probably null Het
Uox T G 3: 146,612,509 V55G possibly damaging Het
Vmn2r24 A T 6: 123,779,001 I11F possibly damaging Het
Wasf2 T C 4: 133,194,909 probably null Het
Zbtb4 T C 11: 69,778,628 S726P possibly damaging Het
Zfp534 C T 4: 147,674,469 C581Y probably damaging Het
Zfp551 A T 7: 12,417,181 C100* probably null Het
Other mutations in As3mt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:As3mt APN 19 46720425 missense probably benign 0.06
IGL00903:As3mt APN 19 46712234 missense probably benign 0.04
IGL02190:As3mt APN 19 46719945 missense probably benign 0.38
IGL03088:As3mt APN 19 46707794 missense probably damaging 1.00
PIT4791001:As3mt UTSW 19 46720349 missense probably damaging 1.00
R1797:As3mt UTSW 19 46724934 missense possibly damaging 0.92
R2157:As3mt UTSW 19 46707792 missense probably benign 0.36
R3113:As3mt UTSW 19 46715278 splice site probably benign
R3816:As3mt UTSW 19 46707777 missense probably benign 0.32
R4819:As3mt UTSW 19 46707529 unclassified probably benign
R5053:As3mt UTSW 19 46709054 missense probably damaging 1.00
R5333:As3mt UTSW 19 46708196 missense probably null 0.97
R6003:As3mt UTSW 19 46708128 missense possibly damaging 0.85
R6269:As3mt UTSW 19 46719952 missense probably damaging 1.00
R6281:As3mt UTSW 19 46724923 missense possibly damaging 0.56
R6317:As3mt UTSW 19 46724971 missense probably benign 0.01
R7346:As3mt UTSW 19 46720452 missense probably damaging 1.00
R8061:As3mt UTSW 19 46740543 missense probably damaging 1.00
R8331:As3mt UTSW 19 46709006 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGCTGCTGCATATCTTATG -3'
(R):5'- CCTTCCTTTATGAAGACAAGCTACG -3'

Sequencing Primer
(F):5'- GCATCTCGAAAAATCTTGCATGTCTG -3'
(R):5'- GACAAGCTACGTTTAGTTTAAATCCC -3'
Posted On2018-09-12