Incidental Mutation 'R6804:Vmn2r54'
ID533483
Institutional Source Beutler Lab
Gene Symbol Vmn2r54
Ensembl Gene ENSMUSG00000096593
Gene Namevomeronasal 2, receptor 54
SynonymsEG666085, Gm470, LOC232871, LOC385080
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R6804 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location12615233-12636134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12629865 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 367 (K367R)
Ref Sequence ENSEMBL: ENSMUSP00000083386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086210]
Predicted Effect probably benign
Transcript: ENSMUST00000086210
AA Change: K367R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083386
Gene: ENSMUSG00000096593
AA Change: K367R

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 4.3e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 1.2e-54 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,869,047 T110A possibly damaging Het
Aox2 A T 1: 58,304,598 Q480L probably benign Het
Arid4b T A 13: 14,129,207 D72E probably benign Het
Avil C T 10: 127,008,306 Q245* probably null Het
BC048679 T C 7: 81,496,864 S2G possibly damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cacna1d T C 14: 30,051,665 T1723A probably benign Het
Chil3 A T 3: 106,164,179 Y56* probably null Het
Clec2i A G 6: 128,895,421 E172G probably damaging Het
Crybg1 C T 10: 43,966,341 D1785N probably damaging Het
Csmd1 G A 8: 16,037,246 R1930W probably damaging Het
D430041D05Rik A C 2: 104,149,026 S2019A possibly damaging Het
Ep300 T A 15: 81,641,311 Y1445* probably null Het
Gne A G 4: 44,060,210 I61T probably damaging Het
Ifit3b A T 19: 34,611,547 Q41L possibly damaging Het
Llgl2 A G 11: 115,843,315 probably null Het
Maats1 T C 16: 38,332,242 D202G probably damaging Het
Mast3 T C 8: 70,786,732 I417V probably benign Het
Mettl21e T A 1: 44,218,135 I8F probably benign Het
Ms4a2 A G 19: 11,617,535 Y183H probably damaging Het
Naip6 C G 13: 100,299,167 E949D probably benign Het
Nbea T C 3: 56,087,453 T181A probably benign Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfm3 A T 3: 115,122,679 Y400F probably benign Het
Olfr102 A G 17: 37,314,130 S85P probably damaging Het
Olfr1391 A G 11: 49,327,981 D190G probably benign Het
Olfr393 A G 11: 73,847,414 V237A probably benign Het
Olfr447 A T 6: 42,911,918 T132S probably benign Het
Pappa2 T C 1: 158,936,868 S358G probably benign Het
Pde4dip C A 3: 97,793,248 E259* probably null Het
Phlpp2 T A 8: 109,928,565 L664Q probably damaging Het
Prpf8 A G 11: 75,499,809 K1262R possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Saal1 GGCTTGCACGCCGT G 7: 46,699,640 probably null Het
Sec31a C T 5: 100,382,812 V701I probably benign Het
Smarca2 A T 19: 26,751,886 R12S possibly damaging Het
Spocd1 T A 4: 129,953,630 C537* probably null Het
Syt14 T C 1: 192,901,853 E701G probably damaging Het
Taf3 T C 2: 9,918,217 Y32C possibly damaging Het
Tfeb T C 17: 47,789,810 probably null Het
Ttc13 C A 8: 124,699,687 R168L probably damaging Het
Vmn2r11 T A 5: 109,053,484 N385Y probably damaging Het
Other mutations in Vmn2r54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Vmn2r54 APN 7 12631913 splice site probably benign
IGL01778:Vmn2r54 APN 7 12632082 missense probably benign 0.07
IGL01998:Vmn2r54 APN 7 12615300 missense probably benign
IGL02028:Vmn2r54 APN 7 12632161 missense probably damaging 1.00
IGL02064:Vmn2r54 APN 7 12615606 missense probably benign 0.02
IGL02238:Vmn2r54 APN 7 12635983 missense probably damaging 1.00
IGL03062:Vmn2r54 APN 7 12632428 missense probably damaging 0.98
IGL03120:Vmn2r54 APN 7 12615387 missense probably damaging 1.00
PIT4453001:Vmn2r54 UTSW 7 12629742 missense probably benign 0.06
R0212:Vmn2r54 UTSW 7 12632497 missense probably benign
R0360:Vmn2r54 UTSW 7 12615649 missense probably damaging 1.00
R1646:Vmn2r54 UTSW 7 12632507 missense probably damaging 1.00
R1673:Vmn2r54 UTSW 7 12616211 critical splice acceptor site probably null
R1738:Vmn2r54 UTSW 7 12635888 missense probably benign 0.00
R1856:Vmn2r54 UTSW 7 12632311 missense probably benign
R2012:Vmn2r54 UTSW 7 12615877 missense probably damaging 1.00
R2038:Vmn2r54 UTSW 7 12629710 missense possibly damaging 0.94
R2160:Vmn2r54 UTSW 7 12615493 missense probably benign 0.29
R2397:Vmn2r54 UTSW 7 12615651 missense probably damaging 0.98
R2430:Vmn2r54 UTSW 7 12632006 missense probably damaging 0.99
R2829:Vmn2r54 UTSW 7 12615690 missense possibly damaging 0.62
R2975:Vmn2r54 UTSW 7 12635992 missense possibly damaging 0.92
R3005:Vmn2r54 UTSW 7 12615294 missense probably benign 0.28
R3725:Vmn2r54 UTSW 7 12632296 missense probably benign 0.42
R4486:Vmn2r54 UTSW 7 12632272 nonsense probably null
R4881:Vmn2r54 UTSW 7 12629671 missense probably benign 0.00
R4907:Vmn2r54 UTSW 7 12616223 splice site probably null
R5536:Vmn2r54 UTSW 7 12632416 missense probably benign 0.03
R5637:Vmn2r54 UTSW 7 12615369 missense probably benign 0.41
R5703:Vmn2r54 UTSW 7 12629667 missense probably benign 0.22
R5769:Vmn2r54 UTSW 7 12615282 missense possibly damaging 0.73
R5972:Vmn2r54 UTSW 7 12615352 missense probably damaging 1.00
R5972:Vmn2r54 UTSW 7 12635947 missense probably damaging 1.00
R5977:Vmn2r54 UTSW 7 12632216 missense probably damaging 1.00
R6084:Vmn2r54 UTSW 7 12632278 missense probably damaging 0.98
R6176:Vmn2r54 UTSW 7 12615981 missense probably damaging 1.00
R6229:Vmn2r54 UTSW 7 12631956 missense probably benign 0.00
R6371:Vmn2r54 UTSW 7 12615435 missense probably damaging 1.00
R6374:Vmn2r54 UTSW 7 12615493 missense probably damaging 1.00
R6886:Vmn2r54 UTSW 7 12632153 missense probably benign 0.02
R7041:Vmn2r54 UTSW 7 12629824 missense probably damaging 0.99
R7058:Vmn2r54 UTSW 7 12615795 missense possibly damaging 0.70
R7113:Vmn2r54 UTSW 7 12616074 missense probably damaging 1.00
R7124:Vmn2r54 UTSW 7 12622151 missense probably benign 0.00
R7126:Vmn2r54 UTSW 7 12632161 missense possibly damaging 0.91
R7236:Vmn2r54 UTSW 7 12631990 missense possibly damaging 0.84
R7337:Vmn2r54 UTSW 7 12622117 missense probably benign 0.00
R7406:Vmn2r54 UTSW 7 12616223 splice site probably null
R7634:Vmn2r54 UTSW 7 12615703 missense probably damaging 1.00
R7793:Vmn2r54 UTSW 7 12632269 missense probably damaging 0.98
R8139:Vmn2r54 UTSW 7 12615816 missense possibly damaging 0.92
R8158:Vmn2r54 UTSW 7 12615961 missense probably damaging 1.00
R8179:Vmn2r54 UTSW 7 12632091 nonsense probably null
R8440:Vmn2r54 UTSW 7 12616086 missense possibly damaging 0.72
U24488:Vmn2r54 UTSW 7 12615429 missense possibly damaging 0.84
X0066:Vmn2r54 UTSW 7 12615370 missense probably damaging 1.00
Z1177:Vmn2r54 UTSW 7 12632108 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACCATCATTTTGTTCCCAGAAGAG -3'
(R):5'- TGGAGCCAGTATCACATTGTG -3'

Sequencing Primer
(F):5'- AGACTTGAGGGTCTATCATGCCTAC -3'
(R):5'- TGAAATCCCCACTGAGTGTG -3'
Posted On2018-09-12