Incidental Mutation 'R6804:Avil'
ID533493
Institutional Source Beutler Lab
Gene Symbol Avil
Ensembl Gene ENSMUSG00000025432
Gene Nameadvillin
SynonymsDOC6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R6804 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location127000709-127020994 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 127008306 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 245 (Q245*)
Ref Sequence ENSEMBL: ENSMUSP00000123405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026500] [ENSMUST00000126816] [ENSMUST00000129173] [ENSMUST00000142698] [ENSMUST00000152054]
Predicted Effect probably null
Transcript: ENSMUST00000026500
AA Change: Q245*
SMART Domains Protein: ENSMUSP00000026500
Gene: ENSMUSG00000025432
AA Change: Q245*

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126816
SMART Domains Protein: ENSMUSP00000115018
Gene: ENSMUSG00000025432

DomainStartEndE-ValueType
Pfam:Gelsolin 23 78 4.4e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129173
AA Change: Q245*
SMART Domains Protein: ENSMUSP00000123405
Gene: ENSMUSG00000025432
AA Change: Q245*

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142698
SMART Domains Protein: ENSMUSP00000117667
Gene: ENSMUSG00000025432

DomainStartEndE-ValueType
SCOP:d1d4xg_ 5 53 2e-17 SMART
PDB:2VIL|A 14 53 2e-14 PDB
Blast:GEL 14 54 7e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000152054
SMART Domains Protein: ENSMUSP00000122669
Gene: ENSMUSG00000040521

DomainStartEndE-ValueType
Pfam:UBA 44 81 1.2e-10 PFAM
SCOP:d1efub4 101 120 5e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the gelsolin/villin family of actin regulatory proteins. This protein has structural similarity to villin. It binds actin and may play a role in the development of neuronal cells that form ganglia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes null mice show partial embryonic lethality before E10.5, but surviving mice are fertile and exhibit no abnormal behavior into adult. The regenerative axon growth and remodeling of sensory nerves are abnormal in homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,869,047 T110A possibly damaging Het
Aox2 A T 1: 58,304,598 Q480L probably benign Het
Arid4b T A 13: 14,129,207 D72E probably benign Het
BC048679 T C 7: 81,496,864 S2G possibly damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cacna1d T C 14: 30,051,665 T1723A probably benign Het
Chil3 A T 3: 106,164,179 Y56* probably null Het
Clec2i A G 6: 128,895,421 E172G probably damaging Het
Crybg1 C T 10: 43,966,341 D1785N probably damaging Het
Csmd1 G A 8: 16,037,246 R1930W probably damaging Het
D430041D05Rik A C 2: 104,149,026 S2019A possibly damaging Het
Ep300 T A 15: 81,641,311 Y1445* probably null Het
Gne A G 4: 44,060,210 I61T probably damaging Het
Ifit3b A T 19: 34,611,547 Q41L possibly damaging Het
Llgl2 A G 11: 115,843,315 probably null Het
Maats1 T C 16: 38,332,242 D202G probably damaging Het
Mast3 T C 8: 70,786,732 I417V probably benign Het
Mettl21e T A 1: 44,218,135 I8F probably benign Het
Ms4a2 A G 19: 11,617,535 Y183H probably damaging Het
Naip6 C G 13: 100,299,167 E949D probably benign Het
Nbea T C 3: 56,087,453 T181A probably benign Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfm3 A T 3: 115,122,679 Y400F probably benign Het
Olfr102 A G 17: 37,314,130 S85P probably damaging Het
Olfr1391 A G 11: 49,327,981 D190G probably benign Het
Olfr393 A G 11: 73,847,414 V237A probably benign Het
Olfr447 A T 6: 42,911,918 T132S probably benign Het
Pappa2 T C 1: 158,936,868 S358G probably benign Het
Pde4dip C A 3: 97,793,248 E259* probably null Het
Phlpp2 T A 8: 109,928,565 L664Q probably damaging Het
Prpf8 A G 11: 75,499,809 K1262R possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Saal1 GGCTTGCACGCCGT G 7: 46,699,640 probably null Het
Sec31a C T 5: 100,382,812 V701I probably benign Het
Smarca2 A T 19: 26,751,886 R12S possibly damaging Het
Spocd1 T A 4: 129,953,630 C537* probably null Het
Syt14 T C 1: 192,901,853 E701G probably damaging Het
Taf3 T C 2: 9,918,217 Y32C possibly damaging Het
Tfeb T C 17: 47,789,810 probably null Het
Ttc13 C A 8: 124,699,687 R168L probably damaging Het
Vmn2r11 T A 5: 109,053,484 N385Y probably damaging Het
Vmn2r54 T C 7: 12,629,865 K367R probably benign Het
Other mutations in Avil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Avil APN 10 127017034 critical splice donor site probably null
IGL01893:Avil APN 10 127020546 missense possibly damaging 0.73
IGL02127:Avil APN 10 127011826 missense probably benign 0.13
IGL02425:Avil APN 10 127018447 missense probably benign
IGL02458:Avil APN 10 127016353 missense probably benign 0.00
IGL02707:Avil APN 10 127006562 missense probably damaging 1.00
IGL02805:Avil APN 10 127007617 missense possibly damaging 0.79
IGL02836:Avil APN 10 127008995 missense probably damaging 1.00
IGL02961:Avil APN 10 127008306 missense probably benign 0.00
IGL03025:Avil APN 10 127013577 missense probably benign 0.19
IGL03083:Avil APN 10 127016324 missense probably benign 0.31
IGL03345:Avil APN 10 127008957 unclassified probably benign
IGL03365:Avil APN 10 127010983 missense probably damaging 1.00
R0109:Avil UTSW 10 127013644 missense probably benign
R0109:Avil UTSW 10 127013644 missense probably benign
R1159:Avil UTSW 10 127011790 missense possibly damaging 0.94
R1631:Avil UTSW 10 127010625 unclassified probably null
R2026:Avil UTSW 10 127011873 missense probably damaging 1.00
R3694:Avil UTSW 10 127008330 missense probably damaging 0.98
R3948:Avil UTSW 10 127014205 missense probably benign 0.00
R4165:Avil UTSW 10 127006627 nonsense probably null
R4978:Avil UTSW 10 127018396 missense probably benign 0.09
R5159:Avil UTSW 10 127020448 critical splice acceptor site probably null
R5254:Avil UTSW 10 127011761 missense probably benign 0.01
R5285:Avil UTSW 10 127018459 missense probably damaging 0.97
R5618:Avil UTSW 10 127010577 missense possibly damaging 0.79
R5682:Avil UTSW 10 127014104 missense probably damaging 1.00
R5786:Avil UTSW 10 127016499 critical splice donor site probably null
R5819:Avil UTSW 10 127009998 missense probably damaging 1.00
R6149:Avil UTSW 10 127006582 missense probably benign 0.25
R6631:Avil UTSW 10 127007749 missense possibly damaging 0.52
R6665:Avil UTSW 10 127020525 missense probably damaging 1.00
R6745:Avil UTSW 10 127014119 missense probably benign 0.00
R6838:Avil UTSW 10 127013562 missense probably benign
R7481:Avil UTSW 10 127007591 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TTCTGGCAAAGGACATTCGG -3'
(R):5'- CAGAAAGGTTCTACCCGCAG -3'

Sequencing Primer
(F):5'- CATTCGGGACAGGGAGCG -3'
(R):5'- AGGATAGCTGCCTCTCTGAG -3'
Posted On2018-09-12