Incidental Mutation 'R6805:Adgrb3'
ID 533509
Institutional Source Beutler Lab
Gene Symbol Adgrb3
Ensembl Gene ENSMUSG00000033569
Gene Name adhesion G protein-coupled receptor B3
Synonyms Bai3, A830096D10Rik
MMRRC Submission 044918-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.409) question?
Stock # R6805 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 25106557-25868788 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25865253 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 197 (T197A)
Ref Sequence ENSEMBL: ENSMUSP00000116231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041838] [ENSMUST00000135518] [ENSMUST00000146592] [ENSMUST00000151309]
AlphaFold Q80ZF8
Predicted Effect possibly damaging
Transcript: ENSMUST00000041838
AA Change: T197A

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035612
Gene: ENSMUSG00000033569
AA Change: T197A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000135518
AA Change: T197A

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119804
Gene: ENSMUSG00000033569
AA Change: T197A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146592
SMART Domains Protein: ENSMUSP00000116759
Gene: ENSMUSG00000033569

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
TSP1 87 136 2.1e-12 SMART
TSP1 141 191 7.97e-13 SMART
TSP1 196 246 6.28e-11 SMART
TSP1 251 301 1.48e-7 SMART
HormR 303 369 4.15e-20 SMART
Pfam:DUF3497 379 603 2.5e-52 PFAM
GPS 608 661 1.24e-21 SMART
Pfam:7tm_2 667 903 5.4e-66 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000151309
AA Change: T197A

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116231
Gene: ENSMUSG00000033569
AA Change: T197A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:GAIN 589 794 1.1e-44 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 875 1143 2.7e-63 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor, a seven-span transmembrane protein, and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities, and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Purkinje cells exhibit impaired motor learning with alterned climbing fiber electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 81,946,744 (GRCm39) T214A possibly damaging Het
A930009A15Rik G T 10: 115,415,810 (GRCm39) probably benign Het
Aadac A C 3: 59,944,757 (GRCm39) D143A probably benign Het
Acot10 T G 15: 20,665,452 (GRCm39) T430P probably benign Het
Bbs1 A G 19: 4,950,643 (GRCm39) I200T probably damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Cadps G A 14: 12,467,103 (GRCm38) A943V probably damaging Het
Cc2d2a A G 5: 43,838,673 (GRCm39) E48G probably damaging Het
Clca3a1 A T 3: 144,724,428 (GRCm39) C211S probably damaging Het
Col18a1 A G 10: 76,890,073 (GRCm39) L1429P probably damaging Het
Cplane1 T C 15: 8,273,790 (GRCm39) V2591A probably benign Het
Cul2 T G 18: 3,421,263 (GRCm39) Y196D probably damaging Het
D630023F18Rik T C 1: 65,156,365 (GRCm39) S43G probably benign Het
Ddx39a G A 8: 84,449,766 (GRCm39) R427Q probably damaging Het
Def6 A G 17: 28,442,691 (GRCm39) T285A probably damaging Het
Defb21 T A 2: 152,416,789 (GRCm39) D88E probably benign Het
Defb6 A G 8: 19,278,117 (GRCm39) K63R probably benign Het
Dnph1 T C 17: 46,809,670 (GRCm39) S112P probably damaging Het
Dock10 T A 1: 80,564,407 (GRCm39) I467L probably benign Het
Dspp C A 5: 104,323,716 (GRCm39) H286Q probably benign Het
Eya1 T A 1: 14,253,501 (GRCm39) T459S probably benign Het
Faf1 T C 4: 109,719,049 (GRCm39) L385P probably damaging Het
Fbxw21 C A 9: 108,986,633 (GRCm39) R82L probably damaging Het
Fryl A G 5: 73,222,437 (GRCm39) V2048A probably benign Het
Galnt5 A T 2: 57,925,311 (GRCm39) D864V possibly damaging Het
Gata6 T G 18: 11,054,460 (GRCm39) S130A possibly damaging Het
Gbf1 G T 19: 46,250,946 (GRCm39) R434L probably damaging Het
Gga3 A G 11: 115,476,588 (GRCm39) F709L probably damaging Het
Hcar1 A G 5: 124,017,193 (GRCm39) V166A probably benign Het
Hexa T A 9: 59,471,220 (GRCm39) N491K possibly damaging Het
Hpse2 A T 19: 43,282,760 (GRCm39) C164* probably null Het
Ifi202b T C 1: 173,802,555 (GRCm39) Y93C probably damaging Het
Iftap T C 2: 101,396,804 (GRCm39) K192E probably benign Het
Iscu T A 5: 113,913,304 (GRCm39) I79N probably damaging Het
Jmjd7 T A 2: 119,861,804 (GRCm39) Y182* probably null Het
Jup A T 11: 100,274,284 (GRCm39) D135E probably benign Het
Kit T A 5: 75,813,468 (GRCm39) I881N probably damaging Het
Llgl1 T A 11: 60,593,691 (GRCm39) S55T probably benign Het
Lonp2 G A 8: 87,435,724 (GRCm39) M653I probably benign Het
Lrp8 T C 4: 107,711,517 (GRCm39) Y307H probably damaging Het
Med13 A T 11: 86,169,622 (GRCm39) M1914K possibly damaging Het
Ms4a1 A G 19: 11,230,537 (GRCm39) probably null Het
Naip1 A G 13: 100,563,849 (GRCm39) S439P probably benign Het
Nrg1 T C 8: 32,311,292 (GRCm39) R476G probably damaging Het
Or10ag59 T A 2: 87,405,262 (GRCm39) probably null Het
Or7g20 G T 9: 18,946,597 (GRCm39) M59I probably damaging Het
Pds5b T A 5: 150,729,026 (GRCm39) probably null Het
Phf12 G A 11: 77,918,199 (GRCm39) G804R probably damaging Het
Pou6f2 T C 13: 18,414,074 (GRCm39) T234A Het
Prune2 A T 19: 17,097,954 (GRCm39) I1153L probably benign Het
Ptprc C T 1: 137,995,623 (GRCm39) probably null Het
Qpctl T C 7: 18,883,079 (GRCm39) Q11R probably benign Het
Rfx4 A G 10: 84,676,092 (GRCm39) K103E possibly damaging Het
Srcin1 T A 11: 97,442,806 (GRCm39) probably null Het
St6galnac1 G T 11: 116,659,770 (GRCm39) A181D probably damaging Het
Stk36 T C 1: 74,661,398 (GRCm39) V475A probably benign Het
Tbc1d21 T C 9: 58,268,571 (GRCm39) T263A possibly damaging Het
Tex24 A T 8: 27,835,028 (GRCm39) K185N probably damaging Het
Tnxb T A 17: 34,917,127 (GRCm39) V2174E possibly damaging Het
Tollip A G 7: 141,444,582 (GRCm39) S57P probably benign Het
Zbtb49 A G 5: 38,370,585 (GRCm39) probably benign Het
Zfp758 A G 17: 22,580,650 (GRCm39) T30A probably benign Het
Other mutations in Adgrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Adgrb3 APN 1 25,267,581 (GRCm39) missense probably benign 0.09
IGL00507:Adgrb3 APN 1 25,113,796 (GRCm39) missense possibly damaging 0.93
IGL00828:Adgrb3 APN 1 25,527,200 (GRCm39) missense possibly damaging 0.73
IGL01285:Adgrb3 APN 1 25,132,868 (GRCm39) missense probably benign 0.32
IGL01309:Adgrb3 APN 1 25,151,352 (GRCm39) missense possibly damaging 0.69
IGL01540:Adgrb3 APN 1 25,151,252 (GRCm39) splice site probably null
IGL01608:Adgrb3 APN 1 25,592,855 (GRCm39) missense probably damaging 1.00
IGL01638:Adgrb3 APN 1 25,598,832 (GRCm39) splice site probably benign
IGL01657:Adgrb3 APN 1 25,865,574 (GRCm39) missense probably benign 0.03
IGL01666:Adgrb3 APN 1 25,499,832 (GRCm39) missense probably damaging 0.96
IGL01712:Adgrb3 APN 1 25,865,360 (GRCm39) missense probably benign
IGL01767:Adgrb3 APN 1 25,598,895 (GRCm39) missense probably benign 0.00
IGL01987:Adgrb3 APN 1 25,140,512 (GRCm39) critical splice donor site probably null
IGL02201:Adgrb3 APN 1 25,459,631 (GRCm39) splice site probably benign
IGL02584:Adgrb3 APN 1 25,544,065 (GRCm39) missense probably damaging 0.98
IGL02685:Adgrb3 APN 1 25,123,323 (GRCm39) critical splice donor site probably null
IGL02886:Adgrb3 APN 1 25,543,991 (GRCm39) splice site probably null
IGL02929:Adgrb3 APN 1 25,592,905 (GRCm39) missense probably benign 0.00
IGL03153:Adgrb3 APN 1 25,570,978 (GRCm39) nonsense probably null
IGL03165:Adgrb3 APN 1 25,133,475 (GRCm39) missense probably benign 0.05
IGL03227:Adgrb3 APN 1 25,586,556 (GRCm39) missense probably damaging 1.00
IGL03392:Adgrb3 APN 1 25,543,529 (GRCm39) missense probably damaging 0.99
schwach UTSW 1 25,150,772 (GRCm39) critical splice donor site probably null
R0007:Adgrb3 UTSW 1 25,150,772 (GRCm39) critical splice donor site probably null
R0048:Adgrb3 UTSW 1 25,140,563 (GRCm39) missense probably benign 0.02
R0048:Adgrb3 UTSW 1 25,140,563 (GRCm39) missense probably benign 0.02
R0322:Adgrb3 UTSW 1 25,260,829 (GRCm39) splice site probably benign
R0442:Adgrb3 UTSW 1 25,435,551 (GRCm39) missense probably damaging 0.96
R0563:Adgrb3 UTSW 1 25,586,635 (GRCm39) missense probably damaging 0.99
R1168:Adgrb3 UTSW 1 25,865,280 (GRCm39) missense probably benign
R1252:Adgrb3 UTSW 1 25,167,909 (GRCm39) missense probably damaging 1.00
R1264:Adgrb3 UTSW 1 25,598,931 (GRCm39) missense probably damaging 0.97
R1543:Adgrb3 UTSW 1 25,527,169 (GRCm39) missense probably benign 0.01
R1577:Adgrb3 UTSW 1 25,133,264 (GRCm39) missense possibly damaging 0.51
R1581:Adgrb3 UTSW 1 25,133,153 (GRCm39) missense possibly damaging 0.94
R1583:Adgrb3 UTSW 1 25,265,912 (GRCm39) splice site probably null
R1653:Adgrb3 UTSW 1 25,140,584 (GRCm39) missense probably benign 0.09
R1725:Adgrb3 UTSW 1 25,865,381 (GRCm39) missense probably damaging 1.00
R1792:Adgrb3 UTSW 1 25,267,552 (GRCm39) missense probably damaging 1.00
R1827:Adgrb3 UTSW 1 25,571,658 (GRCm39) missense probably damaging 0.99
R1838:Adgrb3 UTSW 1 25,123,351 (GRCm39) missense probably damaging 1.00
R1869:Adgrb3 UTSW 1 25,865,519 (GRCm39) missense possibly damaging 0.83
R1971:Adgrb3 UTSW 1 25,586,525 (GRCm39) missense probably benign 0.02
R2005:Adgrb3 UTSW 1 25,150,799 (GRCm39) missense probably benign 0.25
R2134:Adgrb3 UTSW 1 25,133,038 (GRCm39) missense probably damaging 0.99
R2142:Adgrb3 UTSW 1 25,107,290 (GRCm39) missense probably damaging 1.00
R2268:Adgrb3 UTSW 1 25,150,898 (GRCm39) missense possibly damaging 0.79
R3740:Adgrb3 UTSW 1 25,865,535 (GRCm39) missense probably benign 0.00
R3877:Adgrb3 UTSW 1 25,150,906 (GRCm39) missense probably damaging 1.00
R4120:Adgrb3 UTSW 1 25,133,388 (GRCm39) nonsense probably null
R4344:Adgrb3 UTSW 1 25,865,829 (GRCm39) missense possibly damaging 0.61
R4363:Adgrb3 UTSW 1 25,151,303 (GRCm39) missense probably damaging 1.00
R4438:Adgrb3 UTSW 1 25,870,108 (GRCm39) unclassified probably benign
R4465:Adgrb3 UTSW 1 25,133,447 (GRCm39) missense probably damaging 1.00
R4480:Adgrb3 UTSW 1 25,150,829 (GRCm39) missense probably damaging 1.00
R4554:Adgrb3 UTSW 1 25,123,360 (GRCm39) missense probably damaging 1.00
R4557:Adgrb3 UTSW 1 25,123,360 (GRCm39) missense probably damaging 1.00
R4622:Adgrb3 UTSW 1 25,865,569 (GRCm39) missense probably damaging 0.99
R4713:Adgrb3 UTSW 1 25,586,613 (GRCm39) missense probably damaging 1.00
R4772:Adgrb3 UTSW 1 25,570,956 (GRCm39) missense probably damaging 1.00
R4890:Adgrb3 UTSW 1 25,260,908 (GRCm39) missense probably damaging 1.00
R5045:Adgrb3 UTSW 1 25,113,860 (GRCm39) missense probably damaging 1.00
R5061:Adgrb3 UTSW 1 25,107,209 (GRCm39) utr 3 prime probably benign
R5097:Adgrb3 UTSW 1 25,865,165 (GRCm39) missense probably damaging 1.00
R5227:Adgrb3 UTSW 1 25,133,033 (GRCm39) missense possibly damaging 0.55
R5241:Adgrb3 UTSW 1 25,150,871 (GRCm39) missense possibly damaging 0.85
R5328:Adgrb3 UTSW 1 25,133,356 (GRCm39) missense possibly damaging 0.90
R5372:Adgrb3 UTSW 1 25,167,940 (GRCm39) missense probably benign 0.01
R5703:Adgrb3 UTSW 1 25,459,640 (GRCm39) missense probably damaging 1.00
R5747:Adgrb3 UTSW 1 25,865,643 (GRCm39) missense probably damaging 1.00
R5998:Adgrb3 UTSW 1 25,470,582 (GRCm39) splice site probably null
R6006:Adgrb3 UTSW 1 25,865,612 (GRCm39) missense possibly damaging 0.85
R6077:Adgrb3 UTSW 1 25,133,081 (GRCm39) nonsense probably null
R6183:Adgrb3 UTSW 1 25,133,451 (GRCm39) missense probably damaging 0.98
R6190:Adgrb3 UTSW 1 25,459,728 (GRCm39) missense probably benign 0.01
R6249:Adgrb3 UTSW 1 25,471,639 (GRCm39) missense probably damaging 1.00
R6310:Adgrb3 UTSW 1 25,150,799 (GRCm39) missense probably benign 0.13
R6450:Adgrb3 UTSW 1 25,459,683 (GRCm39) missense probably benign
R6678:Adgrb3 UTSW 1 25,499,891 (GRCm39) missense possibly damaging 0.84
R6679:Adgrb3 UTSW 1 25,170,377 (GRCm39) missense probably benign 0.01
R6685:Adgrb3 UTSW 1 25,150,817 (GRCm39) nonsense probably null
R6730:Adgrb3 UTSW 1 25,133,375 (GRCm39) missense probably damaging 1.00
R6847:Adgrb3 UTSW 1 25,133,003 (GRCm39) missense probably benign 0.03
R6929:Adgrb3 UTSW 1 25,150,852 (GRCm39) nonsense probably null
R6953:Adgrb3 UTSW 1 25,865,592 (GRCm39) missense probably damaging 1.00
R7062:Adgrb3 UTSW 1 25,865,166 (GRCm39) missense possibly damaging 0.90
R7244:Adgrb3 UTSW 1 25,170,350 (GRCm39) missense probably damaging 1.00
R7292:Adgrb3 UTSW 1 25,570,957 (GRCm39) missense probably damaging 1.00
R7325:Adgrb3 UTSW 1 25,571,711 (GRCm39) missense probably benign 0.01
R7378:Adgrb3 UTSW 1 25,571,000 (GRCm39) nonsense probably null
R7489:Adgrb3 UTSW 1 25,586,586 (GRCm39) missense probably damaging 1.00
R7615:Adgrb3 UTSW 1 25,137,978 (GRCm39) missense probably damaging 1.00
R7623:Adgrb3 UTSW 1 25,586,629 (GRCm39) missense probably damaging 1.00
R7787:Adgrb3 UTSW 1 25,471,625 (GRCm39) missense probably damaging 1.00
R7837:Adgrb3 UTSW 1 25,167,915 (GRCm39) missense probably damaging 1.00
R8064:Adgrb3 UTSW 1 25,459,637 (GRCm39) critical splice donor site probably null
R8152:Adgrb3 UTSW 1 25,260,838 (GRCm39) splice site probably null
R8161:Adgrb3 UTSW 1 25,133,003 (GRCm39) missense probably benign 0.03
R8225:Adgrb3 UTSW 1 25,865,597 (GRCm39) missense probably benign 0.00
R8417:Adgrb3 UTSW 1 25,527,134 (GRCm39) missense probably benign 0.21
R8694:Adgrb3 UTSW 1 25,865,472 (GRCm39) missense probably damaging 0.98
R8742:Adgrb3 UTSW 1 25,265,835 (GRCm39) missense probably benign 0.01
R8886:Adgrb3 UTSW 1 25,150,928 (GRCm39) missense probably damaging 1.00
R8941:Adgrb3 UTSW 1 25,133,235 (GRCm39) missense probably damaging 1.00
R8958:Adgrb3 UTSW 1 25,865,190 (GRCm39) missense possibly damaging 0.68
R8979:Adgrb3 UTSW 1 25,527,115 (GRCm39) missense probably benign 0.03
R9064:Adgrb3 UTSW 1 25,570,965 (GRCm39) missense possibly damaging 0.86
R9252:Adgrb3 UTSW 1 25,865,496 (GRCm39) missense probably benign 0.03
R9401:Adgrb3 UTSW 1 25,592,783 (GRCm39) missense probably damaging 1.00
R9739:Adgrb3 UTSW 1 25,592,849 (GRCm39) missense probably damaging 1.00
Z1088:Adgrb3 UTSW 1 25,170,352 (GRCm39) missense probably damaging 1.00
Z1176:Adgrb3 UTSW 1 25,132,995 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGGGTTACTTCCATGCAAACC -3'
(R):5'- CCAACTGATTTCCCAGGATTACAG -3'

Sequencing Primer
(F):5'- TCTGAGCACTTACCTTCTTTGGGTG -3'
(R):5'- CAGTTTGGTTGCCATGTC -3'
Posted On 2018-09-12