Incidental Mutation 'R6805:Defb21'
ID 533517
Institutional Source Beutler Lab
Gene Symbol Defb21
Ensembl Gene ENSMUSG00000056544
Gene Name defensin beta 21
Synonyms LOC228782, 4930525K10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R6805 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 152572744-152574944 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 152574869 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 88 (D88E)
Ref Sequence ENSEMBL: ENSMUSP00000065102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053180] [ENSMUST00000070722]
AlphaFold Q8C5Z4
Predicted Effect probably benign
Transcript: ENSMUST00000053180
SMART Domains Protein: ENSMUSP00000059585
Gene: ENSMUSG00000050645

DomainStartEndE-ValueType
Pfam:Defensin_big 2 60 3.4e-9 PFAM
Pfam:Defensin_beta_2 26 55 5.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070722
AA Change: D88E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000065102
Gene: ENSMUSG00000056544
AA Change: D88E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Defensin_beta_2 33 62 1.4e-9 PFAM
low complexity region 76 86 N/A INTRINSIC
Meta Mutation Damage Score 0.0874 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,306 V2591A probably benign Het
4930407I10Rik A G 15: 82,062,543 T214A possibly damaging Het
A930009A15Rik G T 10: 115,579,905 probably benign Het
Aadac A C 3: 60,037,336 D143A probably benign Het
Acot10 T G 15: 20,665,366 T430P probably benign Het
Adgrb3 T C 1: 25,826,172 T197A possibly damaging Het
B230118H07Rik T C 2: 101,566,459 K192E probably benign Het
Bbs1 A G 19: 4,900,615 I200T probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cadps G A 14: 12,467,103 A943V probably damaging Het
Cc2d2a A G 5: 43,681,331 E48G probably damaging Het
Clca1 A T 3: 145,018,667 C211S probably damaging Het
Col18a1 A G 10: 77,054,239 L1429P probably damaging Het
Cul2 T G 18: 3,421,263 Y196D probably damaging Het
D630023F18Rik T C 1: 65,117,206 S43G probably benign Het
Ddx39 G A 8: 83,723,137 R427Q probably damaging Het
Def6 A G 17: 28,223,717 T285A probably damaging Het
Defb6 A G 8: 19,228,101 K63R probably benign Het
Dnph1 T C 17: 46,498,744 S112P probably damaging Het
Dock10 T A 1: 80,586,690 I467L probably benign Het
Dspp C A 5: 104,175,850 H286Q probably benign Het
Eya1 T A 1: 14,183,277 T459S probably benign Het
Faf1 T C 4: 109,861,852 L385P probably damaging Het
Fbxw21 C A 9: 109,157,565 R82L probably damaging Het
Fryl A G 5: 73,065,094 V2048A probably benign Het
Galnt5 A T 2: 58,035,299 D864V possibly damaging Het
Gata6 T G 18: 11,054,460 S130A possibly damaging Het
Gbf1 G T 19: 46,262,507 R434L probably damaging Het
Gga3 A G 11: 115,585,762 F709L probably damaging Het
Hcar1 A G 5: 123,879,130 V166A probably benign Het
Hexa T A 9: 59,563,937 N491K possibly damaging Het
Hpse2 A T 19: 43,294,321 C164* probably null Het
Ifi202b T C 1: 173,974,989 Y93C probably damaging Het
Iscu T A 5: 113,775,243 I79N probably damaging Het
Jmjd7 T A 2: 120,031,323 Y182* probably null Het
Jup A T 11: 100,383,458 D135E probably benign Het
Kit T A 5: 75,652,808 I881N probably damaging Het
Llgl1 T A 11: 60,702,865 S55T probably benign Het
Lonp2 G A 8: 86,709,096 M653I probably benign Het
Lrp8 T C 4: 107,854,320 Y307H probably damaging Het
Med13 A T 11: 86,278,796 M1914K possibly damaging Het
Ms4a1 A G 19: 11,253,173 probably null Het
Naip1 A G 13: 100,427,341 S439P probably benign Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1129 T A 2: 87,574,918 probably null Het
Olfr835 G T 9: 19,035,301 M59I probably damaging Het
Pds5b T A 5: 150,805,561 probably null Het
Phf12 G A 11: 78,027,373 G804R probably damaging Het
Pou6f2 T C 13: 18,239,489 T234A Het
Prune2 A T 19: 17,120,590 I1153L probably benign Het
Ptprc C T 1: 138,067,885 probably null Het
Qpctl T C 7: 19,149,154 Q11R probably benign Het
Rfx4 A G 10: 84,840,228 K103E possibly damaging Het
Srcin1 T A 11: 97,551,980 probably null Het
St6galnac1 G T 11: 116,768,944 A181D probably damaging Het
Stk36 T C 1: 74,622,239 V475A probably benign Het
Tbc1d21 T C 9: 58,361,288 T263A possibly damaging Het
Tex24 A T 8: 27,345,000 K185N probably damaging Het
Tnxb T A 17: 34,698,153 V2174E possibly damaging Het
Tollip A G 7: 141,890,845 S57P probably benign Het
Zbtb49 A G 5: 38,213,241 probably benign Het
Zfp758 A G 17: 22,361,669 T30A probably benign Het
Other mutations in Defb21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Defb21 APN 2 152574792 missense probably benign 0.33
IGL00795:Defb21 APN 2 152574745 missense probably benign 0.00
IGL01301:Defb21 APN 2 152574751 missense possibly damaging 0.85
IGL01686:Defb21 APN 2 152574901 unclassified probably benign
ANU18:Defb21 UTSW 2 152574751 missense possibly damaging 0.85
R2305:Defb21 UTSW 2 152574871 missense possibly damaging 0.96
R2438:Defb21 UTSW 2 152574775 missense possibly damaging 0.71
R8924:Defb21 UTSW 2 152574784 missense possibly damaging 0.51
X0063:Defb21 UTSW 2 152573832 unclassified probably benign
Z1176:Defb21 UTSW 2 152573833 missense unknown
Predicted Primers PCR Primer
(F):5'- CGGTGCTAAGAAAAGATGCTTG -3'
(R):5'- TGGGGATGCTTTACACAGTAGG -3'

Sequencing Primer
(F):5'- AGATGCTTGAAAATTTTGGGGCAC -3'
(R):5'- TACCTAGAGTTACACAGTCACAGTGG -3'
Posted On 2018-09-12