Mutagenetix > Incidental Mutation

Incidental Mutation 'R6805:Clca1'

533519

Institutional Source

Beutler Lab

Gene Symbol

Clca1

Ensembl Gene

ENSMUSG00000028255

Gene Name

chloride channel accessory 1

Synonyms

gob-5, gob5, Clca3

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R6805 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

145003817-145032776 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 145018667 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 211 (C211S)

Ref Sequence

ENSEMBL: ENSMUSP00000029919 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029919]

AlphaFold

Q9D7Z6

Predicted Effect

probably damaging
Transcript: ENSMUST00000029919
AA Change: C211S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029919
Gene: ENSMUSG00000028255
AA Change: C211S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	285	297	N/A	INTRINSIC
VWA	305	478	5.05e-19	SMART
Blast:FN3	753	852	2e-28	BLAST

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.8%
20x: 97.1%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium sensitive chloride conductance protein family. To date, all members of this gene family map to the same region on chromosome 1p31-p22 and share a high degree of homology in size, sequence, and predicted structure, but differ significantly in their tissue distributions. The encoded protein is expressed as a precursor protein that is processed into two cell-surface-associated subunits, although the site at which the precursor is cleaved has not been precisely determined. The encoded protein may be involved in mediating calcium-activated chloride conductance in the intestine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit an exacerbated mucin response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,244,306	V2591A	probably benign	Het
4930407I10Rik	A	G	15: 82,062,543	T214A	possibly damaging	Het
A930009A15Rik	G	T	10: 115,579,905		probably benign	Het
Aadac	A	C	3: 60,037,336	D143A	probably benign	Het
Acot10	T	G	15: 20,665,366	T430P	probably benign	Het
Adgrb3	T	C	1: 25,826,172	T197A	possibly damaging	Het
B230118H07Rik	T	C	2: 101,566,459	K192E	probably benign	Het
Bbs1	A	G	19: 4,900,615	I200T	probably damaging	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
Cadps	G	A	14: 12,467,103	A943V	probably damaging	Het
Cc2d2a	A	G	5: 43,681,331	E48G	probably damaging	Het
Col18a1	A	G	10: 77,054,239	L1429P	probably damaging	Het
Cul2	T	G	18: 3,421,263	Y196D	probably damaging	Het
D630023F18Rik	T	C	1: 65,117,206	S43G	probably benign	Het
Ddx39	G	A	8: 83,723,137	R427Q	probably damaging	Het
Def6	A	G	17: 28,223,717	T285A	probably damaging	Het
Defb21	T	A	2: 152,574,869	D88E	probably benign	Het
Defb6	A	G	8: 19,228,101	K63R	probably benign	Het
Dnph1	T	C	17: 46,498,744	S112P	probably damaging	Het
Dock10	T	A	1: 80,586,690	I467L	probably benign	Het
Dspp	C	A	5: 104,175,850	H286Q	probably benign	Het
Eya1	T	A	1: 14,183,277	T459S	probably benign	Het
Faf1	T	C	4: 109,861,852	L385P	probably damaging	Het
Fbxw21	C	A	9: 109,157,565	R82L	probably damaging	Het
Fryl	A	G	5: 73,065,094	V2048A	probably benign	Het
Galnt5	A	T	2: 58,035,299	D864V	possibly damaging	Het
Gata6	T	G	18: 11,054,460	S130A	possibly damaging	Het
Gbf1	G	T	19: 46,262,507	R434L	probably damaging	Het
Gga3	A	G	11: 115,585,762	F709L	probably damaging	Het
Hcar1	A	G	5: 123,879,130	V166A	probably benign	Het
Hexa	T	A	9: 59,563,937	N491K	possibly damaging	Het
Hpse2	A	T	19: 43,294,321	C164*	probably null	Het
Ifi202b	T	C	1: 173,974,989	Y93C	probably damaging	Het
Iscu	T	A	5: 113,775,243	I79N	probably damaging	Het
Jmjd7	T	A	2: 120,031,323	Y182*	probably null	Het
Jup	A	T	11: 100,383,458	D135E	probably benign	Het
Kit	T	A	5: 75,652,808	I881N	probably damaging	Het
Llgl1	T	A	11: 60,702,865	S55T	probably benign	Het
Lonp2	G	A	8: 86,709,096	M653I	probably benign	Het
Lrp8	T	C	4: 107,854,320	Y307H	probably damaging	Het
Med13	A	T	11: 86,278,796	M1914K	possibly damaging	Het
Ms4a1	A	G	19: 11,253,173		probably null	Het
Naip1	A	G	13: 100,427,341	S439P	probably benign	Het
Nrg1	T	C	8: 31,821,264	R476G	probably damaging	Het
Olfr1129	T	A	2: 87,574,918		probably null	Het
Olfr835	G	T	9: 19,035,301	M59I	probably damaging	Het
Pds5b	T	A	5: 150,805,561		probably null	Het
Phf12	G	A	11: 78,027,373	G804R	probably damaging	Het
Pou6f2	T	C	13: 18,239,489	T234A		Het
Prune2	A	T	19: 17,120,590	I1153L	probably benign	Het
Ptprc	C	T	1: 138,067,885		probably null	Het
Qpctl	T	C	7: 19,149,154	Q11R	probably benign	Het
Rfx4	A	G	10: 84,840,228	K103E	possibly damaging	Het
Srcin1	T	A	11: 97,551,980		probably null	Het
St6galnac1	G	T	11: 116,768,944	A181D	probably damaging	Het
Stk36	T	C	1: 74,622,239	V475A	probably benign	Het
Tbc1d21	T	C	9: 58,361,288	T263A	possibly damaging	Het
Tex24	A	T	8: 27,345,000	K185N	probably damaging	Het
Tnxb	T	A	17: 34,698,153	V2174E	possibly damaging	Het
Tollip	A	G	7: 141,890,845	S57P	probably benign	Het
Zbtb49	A	G	5: 38,213,241		probably benign	Het
Zfp758	A	G	17: 22,361,669	T30A	probably benign	Het

Other mutations in Clca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00664:Clca1	APN	3	145027899	missense	probably benign	0.01
IGL00862:Clca1	APN	3	145024571	missense	possibly damaging	0.89
IGL00895:Clca1	APN	3	145024596	missense	probably damaging	1.00
IGL00969:Clca1	APN	3	145008958	missense	possibly damaging	0.80
IGL01398:Clca1	APN	3	145016751	missense	possibly damaging	0.81
IGL01447:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01455:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01457:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01458:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01462:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01473:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01488:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01490:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01632:Clca1	APN	3	145027441	missense	probably damaging	1.00
IGL01896:Clca1	APN	3	145015677	missense	possibly damaging	0.79
IGL02411:Clca1	APN	3	145028002	missense	possibly damaging	0.89
IGL03156:Clca1	APN	3	145013911	missense	probably damaging	1.00
R0472:Clca1	UTSW	3	145027345	missense	probably damaging	1.00
R0571:Clca1	UTSW	3	145007789	missense	probably damaging	1.00
R0585:Clca1	UTSW	3	145032625	missense	probably benign	0.16
R0586:Clca1	UTSW	3	145032589	missense	probably benign	0.45
R0791:Clca1	UTSW	3	145004854	missense	probably benign	0.01
R1187:Clca1	UTSW	3	145009743	missense	probably benign	0.30
R1713:Clca1	UTSW	3	145024546	missense	probably benign	0.00
R1739:Clca1	UTSW	3	145007778	missense	probably benign	0.00
R2079:Clca1	UTSW	3	145007773	missense	possibly damaging	0.80
R2129:Clca1	UTSW	3	145016765	missense	probably damaging	1.00
R2178:Clca1	UTSW	3	145006102	missense	probably damaging	1.00
R2234:Clca1	UTSW	3	145009068	missense	possibly damaging	0.93
R2235:Clca1	UTSW	3	145009068	missense	possibly damaging	0.93
R2240:Clca1	UTSW	3	145008985	missense	probably damaging	1.00
R3751:Clca1	UTSW	3	145018663	missense	probably benign	0.01
R3974:Clca1	UTSW	3	145032639	missense	probably damaging	1.00
R3975:Clca1	UTSW	3	145032639	missense	probably damaging	1.00
R4409:Clca1	UTSW	3	145006027	missense	probably damaging	1.00
R4586:Clca1	UTSW	3	145016858	missense	probably damaging	1.00
R4751:Clca1	UTSW	3	145004848	missense	possibly damaging	0.89
R4894:Clca1	UTSW	3	145013901	missense	probably damaging	0.99
R4909:Clca1	UTSW	3	145024563	missense	probably damaging	1.00
R4916:Clca1	UTSW	3	145015844	missense	probably benign	0.01
R4941:Clca1	UTSW	3	145015653	missense	probably damaging	1.00
R4942:Clca1	UTSW	3	145004763	missense	probably benign	0.02
R5044:Clca1	UTSW	3	145007928	splice site	probably null
R5451:Clca1	UTSW	3	145027986	missense	probably damaging	1.00
R5618:Clca1	UTSW	3	145004977	missense	probably benign	0.00
R5724:Clca1	UTSW	3	145009072	missense	probably benign	0.01
R5898:Clca1	UTSW	3	145016761	missense	possibly damaging	0.89
R6238:Clca1	UTSW	3	145008955	missense	probably benign	0.09
R6590:Clca1	UTSW	3	145013883	missense	probably damaging	1.00
R6591:Clca1	UTSW	3	145013883	missense	probably damaging	1.00
R6592:Clca1	UTSW	3	145013883	missense	probably damaging	1.00
R6690:Clca1	UTSW	3	145013883	missense	probably damaging	1.00
R6691:Clca1	UTSW	3	145013883	missense	probably damaging	1.00
R6729:Clca1	UTSW	3	145005966	missense	probably damaging	1.00
R7106:Clca1	UTSW	3	145027429	missense	probably damaging	0.98
R7121:Clca1	UTSW	3	145011806	missense	probably damaging	1.00
R7127:Clca1	UTSW	3	145006045	missense	probably damaging	1.00
R7212:Clca1	UTSW	3	145005966	missense	probably damaging	1.00
R7444:Clca1	UTSW	3	145027432	missense	probably damaging	1.00
R7446:Clca1	UTSW	3	145027427	missense	possibly damaging	0.65
R7535:Clca1	UTSW	3	145018567	missense	probably damaging	0.99
R8437:Clca1	UTSW	3	145005061	missense	probably benign	0.00
R8474:Clca1	UTSW	3	145005031	missense	possibly damaging	0.77
R8766:Clca1	UTSW	3	145009178	splice site	probably benign
R8884:Clca1	UTSW	3	145013996	missense	probably benign	0.35
R9049:Clca1	UTSW	3	145027382	missense	probably benign	0.01
R9306:Clca1	UTSW	3	145024578	missense	probably damaging	1.00
R9623:Clca1	UTSW	3	145013937	missense	probably benign	0.03
X0020:Clca1	UTSW	3	145032660	missense	possibly damaging	0.89
Z1176:Clca1	UTSW	3	145013921	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTCCCTTAGAACACCTGGGC -3'
(R):5'- AAACGTAGTGCTGTTGGTATATGAG -3'

Sequencing Primer
(F):5'- CTTAGAACACCTGGGCAAAAC -3'
(R):5'- CTCCTTGGTTTAATGAAAAAGAATCG -3'

Posted On

2018-09-12