Incidental Mutation 'R6805:Lrp8'
ID 533520
Institutional Source Beutler Lab
Gene Symbol Lrp8
Ensembl Gene ENSMUSG00000028613
Gene Name low density lipoprotein receptor-related protein 8, apolipoprotein e receptor
Synonyms Lr8b, 4932703M08Rik, apoER2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.377) question?
Stock # R6805 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 107802261-107876840 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107854320 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 307 (Y307H)
Ref Sequence ENSEMBL: ENSMUSP00000118020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030356] [ENSMUST00000106732] [ENSMUST00000106733] [ENSMUST00000126573] [ENSMUST00000143601]
AlphaFold Q924X6
Predicted Effect probably benign
Transcript: ENSMUST00000030356
AA Change: Y434H

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000030356
Gene: ENSMUSG00000028613
AA Change: Y434H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 160 197 3.52e-14 SMART
LDLa 199 239 8.09e-14 SMART
LDLa 250 288 4.05e-14 SMART
LDLa 290 327 4.58e-13 SMART
EGF 331 367 2.83e-5 SMART
EGF_CA 368 407 9.91e-10 SMART
LY 434 476 8.44e-4 SMART
LY 481 523 2.29e-14 SMART
LY 524 567 5.96e-13 SMART
LY 568 610 4.21e-13 SMART
LY 612 654 7.24e-3 SMART
EGF 681 727 1.56e1 SMART
low complexity region 729 745 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
low complexity region 863 869 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000102342
Gene: ENSMUSG00000028613
AA Change: Y236H

DomainStartEndE-ValueType
EGF_like 9 47 3.29e1 SMART
LDLa 9 48 2.45e-13 SMART
LDLa 50 89 1.19e-11 SMART
LDLa 93 130 4.58e-13 SMART
EGF 134 170 2.83e-5 SMART
EGF_CA 171 210 9.91e-10 SMART
LY 237 279 8.44e-4 SMART
LY 284 326 2.29e-14 SMART
LY 327 370 5.96e-13 SMART
LY 371 413 4.21e-13 SMART
LY 415 457 7.24e-3 SMART
EGF 484 530 1.56e1 SMART
low complexity region 532 548 N/A INTRINSIC
low complexity region 586 601 N/A INTRINSIC
transmembrane domain 621 643 N/A INTRINSIC
low complexity region 666 672 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106732
AA Change: Y349H

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102343
Gene: ENSMUSG00000028613
AA Change: Y349H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 164 201 4.58e-13 SMART
LDLa 204 244 1.4e-8 SMART
EGF 246 282 2.83e-5 SMART
EGF_CA 283 322 9.91e-10 SMART
LY 349 391 8.44e-4 SMART
LY 396 438 2.29e-14 SMART
LY 439 482 5.96e-13 SMART
LY 483 525 4.21e-13 SMART
LY 527 569 7.24e-3 SMART
EGF 596 642 1.56e1 SMART
low complexity region 644 660 N/A INTRINSIC
low complexity region 698 713 N/A INTRINSIC
transmembrane domain 733 755 N/A INTRINSIC
low complexity region 778 784 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106733
AA Change: Y434H

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102344
Gene: ENSMUSG00000028613
AA Change: Y434H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 160 197 3.52e-14 SMART
LDLa 199 239 8.09e-14 SMART
LDLa 250 288 4.05e-14 SMART
LDLa 290 327 4.58e-13 SMART
EGF 331 367 2.83e-5 SMART
EGF_CA 368 407 9.91e-10 SMART
LY 434 476 8.44e-4 SMART
LY 481 523 2.29e-14 SMART
LY 524 567 5.96e-13 SMART
LY 568 610 4.21e-13 SMART
LY 612 654 7.24e-3 SMART
EGF 681 727 1.56e1 SMART
low complexity region 729 745 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
low complexity region 863 869 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126573
AA Change: Y307H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118020
Gene: ENSMUSG00000028613
AA Change: Y307H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 163 200 4.58e-13 SMART
EGF 204 240 2.83e-5 SMART
EGF_CA 241 280 9.91e-10 SMART
LY 307 349 8.44e-4 SMART
LY 354 396 2.29e-14 SMART
LY 397 440 5.96e-13 SMART
LY 441 483 4.21e-13 SMART
LY 485 527 7.24e-3 SMART
EGF 554 600 1.56e1 SMART
transmembrane domain 616 638 N/A INTRINSIC
low complexity region 661 667 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143601
AA Change: Y475H

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000115854
Gene: ENSMUSG00000028613
AA Change: Y475H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 160 197 3.52e-14 SMART
LDLa 199 239 8.09e-14 SMART
LDLa 250 288 4.05e-14 SMART
LDLa 290 327 4.58e-13 SMART
LDLa 330 370 1.4e-8 SMART
EGF 372 408 2.83e-5 SMART
EGF_CA 409 448 9.91e-10 SMART
LY 475 517 8.44e-4 SMART
LY 522 564 2.29e-14 SMART
LY 565 608 5.96e-13 SMART
LY 609 651 4.21e-13 SMART
LY 653 695 7.24e-3 SMART
EGF 722 768 1.56e1 SMART
low complexity region 770 786 N/A INTRINSIC
low complexity region 824 839 N/A INTRINSIC
transmembrane domain 859 881 N/A INTRINSIC
low complexity region 904 910 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein receptor (LDLR) family. Low density lipoprotein receptors are cell surface proteins that play roles in both signal transduction and receptor-mediated endocytosis of specific ligands for lysosomal degradation. The encoded protein plays a critical role in the migration of neurons during development by mediating Reelin signaling, and also functions as a receptor for the cholesterol transport protein apolipoprotein E. Expression of this gene may be a marker for major depressive disorder. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired granule cell migration, radial glial scaffold formation, contextual fear conditioning, and long-term potentiation. Mutant males have abnormal sperm and are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,306 V2591A probably benign Het
4930407I10Rik A G 15: 82,062,543 T214A possibly damaging Het
A930009A15Rik G T 10: 115,579,905 probably benign Het
Aadac A C 3: 60,037,336 D143A probably benign Het
Acot10 T G 15: 20,665,366 T430P probably benign Het
Adgrb3 T C 1: 25,826,172 T197A possibly damaging Het
B230118H07Rik T C 2: 101,566,459 K192E probably benign Het
Bbs1 A G 19: 4,900,615 I200T probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cadps G A 14: 12,467,103 A943V probably damaging Het
Cc2d2a A G 5: 43,681,331 E48G probably damaging Het
Clca1 A T 3: 145,018,667 C211S probably damaging Het
Col18a1 A G 10: 77,054,239 L1429P probably damaging Het
Cul2 T G 18: 3,421,263 Y196D probably damaging Het
D630023F18Rik T C 1: 65,117,206 S43G probably benign Het
Ddx39 G A 8: 83,723,137 R427Q probably damaging Het
Def6 A G 17: 28,223,717 T285A probably damaging Het
Defb21 T A 2: 152,574,869 D88E probably benign Het
Defb6 A G 8: 19,228,101 K63R probably benign Het
Dnph1 T C 17: 46,498,744 S112P probably damaging Het
Dock10 T A 1: 80,586,690 I467L probably benign Het
Dspp C A 5: 104,175,850 H286Q probably benign Het
Eya1 T A 1: 14,183,277 T459S probably benign Het
Faf1 T C 4: 109,861,852 L385P probably damaging Het
Fbxw21 C A 9: 109,157,565 R82L probably damaging Het
Fryl A G 5: 73,065,094 V2048A probably benign Het
Galnt5 A T 2: 58,035,299 D864V possibly damaging Het
Gata6 T G 18: 11,054,460 S130A possibly damaging Het
Gbf1 G T 19: 46,262,507 R434L probably damaging Het
Gga3 A G 11: 115,585,762 F709L probably damaging Het
Hcar1 A G 5: 123,879,130 V166A probably benign Het
Hexa T A 9: 59,563,937 N491K possibly damaging Het
Hpse2 A T 19: 43,294,321 C164* probably null Het
Ifi202b T C 1: 173,974,989 Y93C probably damaging Het
Iscu T A 5: 113,775,243 I79N probably damaging Het
Jmjd7 T A 2: 120,031,323 Y182* probably null Het
Jup A T 11: 100,383,458 D135E probably benign Het
Kit T A 5: 75,652,808 I881N probably damaging Het
Llgl1 T A 11: 60,702,865 S55T probably benign Het
Lonp2 G A 8: 86,709,096 M653I probably benign Het
Med13 A T 11: 86,278,796 M1914K possibly damaging Het
Ms4a1 A G 19: 11,253,173 probably null Het
Naip1 A G 13: 100,427,341 S439P probably benign Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1129 T A 2: 87,574,918 probably null Het
Olfr835 G T 9: 19,035,301 M59I probably damaging Het
Pds5b T A 5: 150,805,561 probably null Het
Phf12 G A 11: 78,027,373 G804R probably damaging Het
Pou6f2 T C 13: 18,239,489 T234A Het
Prune2 A T 19: 17,120,590 I1153L probably benign Het
Ptprc C T 1: 138,067,885 probably null Het
Qpctl T C 7: 19,149,154 Q11R probably benign Het
Rfx4 A G 10: 84,840,228 K103E possibly damaging Het
Srcin1 T A 11: 97,551,980 probably null Het
St6galnac1 G T 11: 116,768,944 A181D probably damaging Het
Stk36 T C 1: 74,622,239 V475A probably benign Het
Tbc1d21 T C 9: 58,361,288 T263A possibly damaging Het
Tex24 A T 8: 27,345,000 K185N probably damaging Het
Tnxb T A 17: 34,698,153 V2174E possibly damaging Het
Tollip A G 7: 141,890,845 S57P probably benign Het
Zbtb49 A G 5: 38,213,241 probably benign Het
Zfp758 A G 17: 22,361,669 T30A probably benign Het
Other mutations in Lrp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Lrp8 APN 4 107864076 missense probably benign 0.04
IGL01514:Lrp8 APN 4 107855684 missense probably damaging 1.00
IGL02058:Lrp8 APN 4 107870109 missense probably benign 0.25
IGL02398:Lrp8 APN 4 107847494 missense probably damaging 0.97
IGL02398:Lrp8 APN 4 107869048 missense probably damaging 1.00
IGL02706:Lrp8 APN 4 107803319 nonsense probably null
IGL02754:Lrp8 APN 4 107834755 splice site probably null
IGL02967:Lrp8 APN 4 107861234 missense probably benign 0.21
IGL03080:Lrp8 APN 4 107855799 missense probably damaging 1.00
IGL02837:Lrp8 UTSW 4 107861281 missense probably benign 0.01
R0312:Lrp8 UTSW 4 107806855 intron probably benign
R0440:Lrp8 UTSW 4 107869098 missense probably damaging 0.99
R0598:Lrp8 UTSW 4 107857237 missense possibly damaging 0.73
R1627:Lrp8 UTSW 4 107854416 missense probably damaging 0.99
R1967:Lrp8 UTSW 4 107859971 missense probably damaging 1.00
R2183:Lrp8 UTSW 4 107803265 missense probably damaging 1.00
R2208:Lrp8 UTSW 4 107855790 missense probably damaging 1.00
R2325:Lrp8 UTSW 4 107864009 missense probably benign 0.03
R3712:Lrp8 UTSW 4 107848302 missense probably benign 0.08
R4093:Lrp8 UTSW 4 107843271 nonsense probably null
R4706:Lrp8 UTSW 4 107861273 missense probably benign 0.00
R4765:Lrp8 UTSW 4 107854395 missense probably damaging 1.00
R4840:Lrp8 UTSW 4 107870037 missense possibly damaging 0.79
R4900:Lrp8 UTSW 4 107806809 intron probably benign
R5033:Lrp8 UTSW 4 107834755 splice site probably null
R5280:Lrp8 UTSW 4 107854321 missense probably damaging 1.00
R5381:Lrp8 UTSW 4 107869110 missense probably damaging 1.00
R5935:Lrp8 UTSW 4 107857296 missense probably damaging 1.00
R5972:Lrp8 UTSW 4 107869070 missense probably damaging 1.00
R6076:Lrp8 UTSW 4 107847459 missense possibly damaging 0.81
R6343:Lrp8 UTSW 4 107869156 splice site probably null
R7100:Lrp8 UTSW 4 107802450 missense possibly damaging 0.93
R7262:Lrp8 UTSW 4 107847464 missense probably benign
R7717:Lrp8 UTSW 4 107834743 missense probably benign 0.00
R7949:Lrp8 UTSW 4 107803327 missense probably damaging 1.00
R8350:Lrp8 UTSW 4 107847464 missense probably benign
R8371:Lrp8 UTSW 4 107869071 missense probably damaging 1.00
R9272:Lrp8 UTSW 4 107859961 missense probably benign 0.19
R9461:Lrp8 UTSW 4 107843318 missense possibly damaging 0.93
R9567:Lrp8 UTSW 4 107854272 missense probably damaging 0.99
Z1177:Lrp8 UTSW 4 107843332 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCTAGCCTGTGAGGTAGGGAC -3'
(R):5'- GATTCCATGTCCCCTGTCAAG -3'

Sequencing Primer
(F):5'- GGACCATCATCCCCACTTCATAGG -3'
(R):5'- TGTCAAGCCCAACTGCC -3'
Posted On 2018-09-12