Incidental Mutation 'R6805:Zbtb49'
ID 533522
Institutional Source Beutler Lab
Gene Symbol Zbtb49
Ensembl Gene ENSMUSG00000029127
Gene Name zinc finger and BTB domain containing 49
Synonyms Zfp509, 4930518A03Rik
MMRRC Submission 044918-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R6805 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 38347076-38377798 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to G at 38370585 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094833] [ENSMUST00000114113] [ENSMUST00000123106] [ENSMUST00000126267] [ENSMUST00000136475] [ENSMUST00000138820] [ENSMUST00000143436]
AlphaFold Q8BXX2
Predicted Effect probably benign
Transcript: ENSMUST00000094833
SMART Domains Protein: ENSMUSP00000092429
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
ZnF_C2H2 414 436 6.99e-5 SMART
ZnF_C2H2 442 464 2.24e-3 SMART
ZnF_C2H2 470 492 1.26e-2 SMART
ZnF_C2H2 498 520 5.14e-3 SMART
ZnF_C2H2 526 548 2.27e-4 SMART
ZnF_C2H2 554 576 3.39e-3 SMART
low complexity region 597 614 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000114113
AA Change: V432A
SMART Domains Protein: ENSMUSP00000109748
Gene: ENSMUSG00000029127
AA Change: V432A

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
low complexity region 413 430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123106
SMART Domains Protein: ENSMUSP00000144200
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 12 51 1.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126267
SMART Domains Protein: ENSMUSP00000122109
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129161
Predicted Effect probably benign
Transcript: ENSMUST00000136475
SMART Domains Protein: ENSMUSP00000117174
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138820
SMART Domains Protein: ENSMUSP00000117913
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 13 63 4.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143436
SMART Domains Protein: ENSMUSP00000115513
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 15 75 1.5e-11 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 81,946,744 (GRCm39) T214A possibly damaging Het
A930009A15Rik G T 10: 115,415,810 (GRCm39) probably benign Het
Aadac A C 3: 59,944,757 (GRCm39) D143A probably benign Het
Acot10 T G 15: 20,665,452 (GRCm39) T430P probably benign Het
Adgrb3 T C 1: 25,865,253 (GRCm39) T197A possibly damaging Het
Bbs1 A G 19: 4,950,643 (GRCm39) I200T probably damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Cadps G A 14: 12,467,103 (GRCm38) A943V probably damaging Het
Cc2d2a A G 5: 43,838,673 (GRCm39) E48G probably damaging Het
Clca3a1 A T 3: 144,724,428 (GRCm39) C211S probably damaging Het
Col18a1 A G 10: 76,890,073 (GRCm39) L1429P probably damaging Het
Cplane1 T C 15: 8,273,790 (GRCm39) V2591A probably benign Het
Cul2 T G 18: 3,421,263 (GRCm39) Y196D probably damaging Het
D630023F18Rik T C 1: 65,156,365 (GRCm39) S43G probably benign Het
Ddx39a G A 8: 84,449,766 (GRCm39) R427Q probably damaging Het
Def6 A G 17: 28,442,691 (GRCm39) T285A probably damaging Het
Defb21 T A 2: 152,416,789 (GRCm39) D88E probably benign Het
Defb6 A G 8: 19,278,117 (GRCm39) K63R probably benign Het
Dnph1 T C 17: 46,809,670 (GRCm39) S112P probably damaging Het
Dock10 T A 1: 80,564,407 (GRCm39) I467L probably benign Het
Dspp C A 5: 104,323,716 (GRCm39) H286Q probably benign Het
Eya1 T A 1: 14,253,501 (GRCm39) T459S probably benign Het
Faf1 T C 4: 109,719,049 (GRCm39) L385P probably damaging Het
Fbxw21 C A 9: 108,986,633 (GRCm39) R82L probably damaging Het
Fryl A G 5: 73,222,437 (GRCm39) V2048A probably benign Het
Galnt5 A T 2: 57,925,311 (GRCm39) D864V possibly damaging Het
Gata6 T G 18: 11,054,460 (GRCm39) S130A possibly damaging Het
Gbf1 G T 19: 46,250,946 (GRCm39) R434L probably damaging Het
Gga3 A G 11: 115,476,588 (GRCm39) F709L probably damaging Het
Hcar1 A G 5: 124,017,193 (GRCm39) V166A probably benign Het
Hexa T A 9: 59,471,220 (GRCm39) N491K possibly damaging Het
Hpse2 A T 19: 43,282,760 (GRCm39) C164* probably null Het
Ifi202b T C 1: 173,802,555 (GRCm39) Y93C probably damaging Het
Iftap T C 2: 101,396,804 (GRCm39) K192E probably benign Het
Iscu T A 5: 113,913,304 (GRCm39) I79N probably damaging Het
Jmjd7 T A 2: 119,861,804 (GRCm39) Y182* probably null Het
Jup A T 11: 100,274,284 (GRCm39) D135E probably benign Het
Kit T A 5: 75,813,468 (GRCm39) I881N probably damaging Het
Llgl1 T A 11: 60,593,691 (GRCm39) S55T probably benign Het
Lonp2 G A 8: 87,435,724 (GRCm39) M653I probably benign Het
Lrp8 T C 4: 107,711,517 (GRCm39) Y307H probably damaging Het
Med13 A T 11: 86,169,622 (GRCm39) M1914K possibly damaging Het
Ms4a1 A G 19: 11,230,537 (GRCm39) probably null Het
Naip1 A G 13: 100,563,849 (GRCm39) S439P probably benign Het
Nrg1 T C 8: 32,311,292 (GRCm39) R476G probably damaging Het
Or10ag59 T A 2: 87,405,262 (GRCm39) probably null Het
Or7g20 G T 9: 18,946,597 (GRCm39) M59I probably damaging Het
Pds5b T A 5: 150,729,026 (GRCm39) probably null Het
Phf12 G A 11: 77,918,199 (GRCm39) G804R probably damaging Het
Pou6f2 T C 13: 18,414,074 (GRCm39) T234A Het
Prune2 A T 19: 17,097,954 (GRCm39) I1153L probably benign Het
Ptprc C T 1: 137,995,623 (GRCm39) probably null Het
Qpctl T C 7: 18,883,079 (GRCm39) Q11R probably benign Het
Rfx4 A G 10: 84,676,092 (GRCm39) K103E possibly damaging Het
Srcin1 T A 11: 97,442,806 (GRCm39) probably null Het
St6galnac1 G T 11: 116,659,770 (GRCm39) A181D probably damaging Het
Stk36 T C 1: 74,661,398 (GRCm39) V475A probably benign Het
Tbc1d21 T C 9: 58,268,571 (GRCm39) T263A possibly damaging Het
Tex24 A T 8: 27,835,028 (GRCm39) K185N probably damaging Het
Tnxb T A 17: 34,917,127 (GRCm39) V2174E possibly damaging Het
Tollip A G 7: 141,444,582 (GRCm39) S57P probably benign Het
Zfp758 A G 17: 22,580,650 (GRCm39) T30A probably benign Het
Other mutations in Zbtb49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Zbtb49 APN 5 38,367,960 (GRCm39) critical splice donor site probably null
IGL01736:Zbtb49 APN 5 38,358,204 (GRCm39) missense probably damaging 1.00
PIT4585001:Zbtb49 UTSW 5 38,373,820 (GRCm39) missense probably damaging 1.00
R0443:Zbtb49 UTSW 5 38,358,174 (GRCm39) missense probably benign 0.08
R0526:Zbtb49 UTSW 5 38,371,263 (GRCm39) missense probably benign 0.08
R0646:Zbtb49 UTSW 5 38,358,018 (GRCm39) missense probably damaging 1.00
R1200:Zbtb49 UTSW 5 38,370,675 (GRCm39) missense probably damaging 1.00
R1678:Zbtb49 UTSW 5 38,371,038 (GRCm39) missense probably damaging 0.97
R1964:Zbtb49 UTSW 5 38,361,105 (GRCm39) nonsense probably null
R2155:Zbtb49 UTSW 5 38,371,464 (GRCm39) missense possibly damaging 0.86
R2483:Zbtb49 UTSW 5 38,360,701 (GRCm39) intron probably benign
R3617:Zbtb49 UTSW 5 38,357,975 (GRCm39) unclassified probably benign
R4937:Zbtb49 UTSW 5 38,371,307 (GRCm39) missense possibly damaging 0.76
R5579:Zbtb49 UTSW 5 38,358,160 (GRCm39) missense probably damaging 0.99
R5699:Zbtb49 UTSW 5 38,373,870 (GRCm39) missense probably damaging 1.00
R6354:Zbtb49 UTSW 5 38,360,903 (GRCm39) missense possibly damaging 0.58
R6426:Zbtb49 UTSW 5 38,360,431 (GRCm39) splice site probably null
R6735:Zbtb49 UTSW 5 38,358,402 (GRCm39) missense possibly damaging 0.74
R6869:Zbtb49 UTSW 5 38,371,694 (GRCm39) missense probably damaging 1.00
R7020:Zbtb49 UTSW 5 38,370,711 (GRCm39) nonsense probably null
R7899:Zbtb49 UTSW 5 38,371,274 (GRCm39) nonsense probably null
R8041:Zbtb49 UTSW 5 38,358,198 (GRCm39) missense possibly damaging 0.61
R8461:Zbtb49 UTSW 5 38,358,453 (GRCm39) missense probably benign 0.04
R8517:Zbtb49 UTSW 5 38,357,997 (GRCm39) missense probably benign 0.25
R8523:Zbtb49 UTSW 5 38,370,669 (GRCm39) missense probably damaging 1.00
R9068:Zbtb49 UTSW 5 38,358,289 (GRCm39) missense probably benign
R9160:Zbtb49 UTSW 5 38,363,246 (GRCm39) missense probably damaging 0.99
R9301:Zbtb49 UTSW 5 38,370,931 (GRCm39) missense probably benign
R9315:Zbtb49 UTSW 5 38,358,082 (GRCm39) missense probably benign 0.05
R9480:Zbtb49 UTSW 5 38,358,409 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TTTTAGAGTTAGCAGGCTGAGAGC -3'
(R):5'- TGGAAGCCAGACTGCTGAAG -3'

Sequencing Primer
(F):5'- AGCATCTCAGCAGCTGACAGTG -3'
(R):5'- ACTGGGTCCAGAGAGCAGC -3'
Posted On 2018-09-12