Incidental Mutation 'R6805:Cc2d2a'
ID 533523
Institutional Source Beutler Lab
Gene Symbol Cc2d2a
Ensembl Gene ENSMUSG00000039765
Gene Name coiled-coil and C2 domain containing 2A
Synonyms b2b1035Clo, 5730509K17Rik
MMRRC Submission 044918-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.914) question?
Stock # R6805 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 43819715-43898317 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43838673 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 48 (E48G)
Ref Sequence ENSEMBL: ENSMUSP00000114349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]
AlphaFold Q8CFW7
Predicted Effect probably damaging
Transcript: ENSMUST00000048150
AA Change: E97G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: E97G

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
coiled coil region 472 501 N/A INTRINSIC
coiled coil region 553 582 N/A INTRINSIC
Pfam:CC2D2AN-C2 645 817 2e-36 PFAM
low complexity region 1005 1017 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
C2 1048 1208 3.43e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125866
AA Change: E48G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765
AA Change: E48G

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 423 452 N/A INTRINSIC
coiled coil region 504 533 N/A INTRINSIC
Pfam:CC2D2AN-C2 596 768 7.7e-44 PFAM
low complexity region 970 982 N/A INTRINSIC
C2 994 1154 2.3e-7 SMART
Meta Mutation Damage Score 0.1186 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 81,946,744 (GRCm39) T214A possibly damaging Het
A930009A15Rik G T 10: 115,415,810 (GRCm39) probably benign Het
Aadac A C 3: 59,944,757 (GRCm39) D143A probably benign Het
Acot10 T G 15: 20,665,452 (GRCm39) T430P probably benign Het
Adgrb3 T C 1: 25,865,253 (GRCm39) T197A possibly damaging Het
Bbs1 A G 19: 4,950,643 (GRCm39) I200T probably damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Cadps G A 14: 12,467,103 (GRCm38) A943V probably damaging Het
Clca3a1 A T 3: 144,724,428 (GRCm39) C211S probably damaging Het
Col18a1 A G 10: 76,890,073 (GRCm39) L1429P probably damaging Het
Cplane1 T C 15: 8,273,790 (GRCm39) V2591A probably benign Het
Cul2 T G 18: 3,421,263 (GRCm39) Y196D probably damaging Het
D630023F18Rik T C 1: 65,156,365 (GRCm39) S43G probably benign Het
Ddx39a G A 8: 84,449,766 (GRCm39) R427Q probably damaging Het
Def6 A G 17: 28,442,691 (GRCm39) T285A probably damaging Het
Defb21 T A 2: 152,416,789 (GRCm39) D88E probably benign Het
Defb6 A G 8: 19,278,117 (GRCm39) K63R probably benign Het
Dnph1 T C 17: 46,809,670 (GRCm39) S112P probably damaging Het
Dock10 T A 1: 80,564,407 (GRCm39) I467L probably benign Het
Dspp C A 5: 104,323,716 (GRCm39) H286Q probably benign Het
Eya1 T A 1: 14,253,501 (GRCm39) T459S probably benign Het
Faf1 T C 4: 109,719,049 (GRCm39) L385P probably damaging Het
Fbxw21 C A 9: 108,986,633 (GRCm39) R82L probably damaging Het
Fryl A G 5: 73,222,437 (GRCm39) V2048A probably benign Het
Galnt5 A T 2: 57,925,311 (GRCm39) D864V possibly damaging Het
Gata6 T G 18: 11,054,460 (GRCm39) S130A possibly damaging Het
Gbf1 G T 19: 46,250,946 (GRCm39) R434L probably damaging Het
Gga3 A G 11: 115,476,588 (GRCm39) F709L probably damaging Het
Hcar1 A G 5: 124,017,193 (GRCm39) V166A probably benign Het
Hexa T A 9: 59,471,220 (GRCm39) N491K possibly damaging Het
Hpse2 A T 19: 43,282,760 (GRCm39) C164* probably null Het
Ifi202b T C 1: 173,802,555 (GRCm39) Y93C probably damaging Het
Iftap T C 2: 101,396,804 (GRCm39) K192E probably benign Het
Iscu T A 5: 113,913,304 (GRCm39) I79N probably damaging Het
Jmjd7 T A 2: 119,861,804 (GRCm39) Y182* probably null Het
Jup A T 11: 100,274,284 (GRCm39) D135E probably benign Het
Kit T A 5: 75,813,468 (GRCm39) I881N probably damaging Het
Llgl1 T A 11: 60,593,691 (GRCm39) S55T probably benign Het
Lonp2 G A 8: 87,435,724 (GRCm39) M653I probably benign Het
Lrp8 T C 4: 107,711,517 (GRCm39) Y307H probably damaging Het
Med13 A T 11: 86,169,622 (GRCm39) M1914K possibly damaging Het
Ms4a1 A G 19: 11,230,537 (GRCm39) probably null Het
Naip1 A G 13: 100,563,849 (GRCm39) S439P probably benign Het
Nrg1 T C 8: 32,311,292 (GRCm39) R476G probably damaging Het
Or10ag59 T A 2: 87,405,262 (GRCm39) probably null Het
Or7g20 G T 9: 18,946,597 (GRCm39) M59I probably damaging Het
Pds5b T A 5: 150,729,026 (GRCm39) probably null Het
Phf12 G A 11: 77,918,199 (GRCm39) G804R probably damaging Het
Pou6f2 T C 13: 18,414,074 (GRCm39) T234A Het
Prune2 A T 19: 17,097,954 (GRCm39) I1153L probably benign Het
Ptprc C T 1: 137,995,623 (GRCm39) probably null Het
Qpctl T C 7: 18,883,079 (GRCm39) Q11R probably benign Het
Rfx4 A G 10: 84,676,092 (GRCm39) K103E possibly damaging Het
Srcin1 T A 11: 97,442,806 (GRCm39) probably null Het
St6galnac1 G T 11: 116,659,770 (GRCm39) A181D probably damaging Het
Stk36 T C 1: 74,661,398 (GRCm39) V475A probably benign Het
Tbc1d21 T C 9: 58,268,571 (GRCm39) T263A possibly damaging Het
Tex24 A T 8: 27,835,028 (GRCm39) K185N probably damaging Het
Tnxb T A 17: 34,917,127 (GRCm39) V2174E possibly damaging Het
Tollip A G 7: 141,444,582 (GRCm39) S57P probably benign Het
Zbtb49 A G 5: 38,370,585 (GRCm39) probably benign Het
Zfp758 A G 17: 22,580,650 (GRCm39) T30A probably benign Het
Other mutations in Cc2d2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cc2d2a APN 5 43,881,722 (GRCm39) splice site probably benign
IGL00937:Cc2d2a APN 5 43,845,464 (GRCm39) critical splice acceptor site probably null
IGL01322:Cc2d2a APN 5 43,846,345 (GRCm39) missense probably benign 0.00
IGL01349:Cc2d2a APN 5 43,881,126 (GRCm39) missense probably benign 0.01
IGL01448:Cc2d2a APN 5 43,841,527 (GRCm39) missense possibly damaging 0.65
IGL01871:Cc2d2a APN 5 43,846,311 (GRCm39) missense probably damaging 0.98
IGL01947:Cc2d2a APN 5 43,845,579 (GRCm39) missense probably damaging 0.96
IGL01976:Cc2d2a APN 5 43,840,457 (GRCm39) missense probably benign 0.02
IGL02113:Cc2d2a APN 5 43,842,590 (GRCm39) splice site probably null
IGL02364:Cc2d2a APN 5 43,892,792 (GRCm39) missense probably damaging 1.00
IGL02448:Cc2d2a APN 5 43,840,547 (GRCm39) splice site probably benign
IGL02458:Cc2d2a APN 5 43,875,896 (GRCm39) missense probably benign 0.01
IGL02542:Cc2d2a APN 5 43,846,252 (GRCm39) splice site probably benign
IGL02834:Cc2d2a APN 5 43,871,863 (GRCm39) nonsense probably null
IGL02940:Cc2d2a APN 5 43,885,636 (GRCm39) splice site probably null
IGL03003:Cc2d2a APN 5 43,828,608 (GRCm39) missense probably benign 0.22
IGL03183:Cc2d2a APN 5 43,889,721 (GRCm39) missense probably damaging 1.00
C9142:Cc2d2a UTSW 5 43,892,799 (GRCm39) splice site probably benign
P0028:Cc2d2a UTSW 5 43,841,541 (GRCm39) missense probably benign
R0193:Cc2d2a UTSW 5 43,893,460 (GRCm39) missense probably damaging 1.00
R0201:Cc2d2a UTSW 5 43,894,854 (GRCm39) missense probably damaging 1.00
R0211:Cc2d2a UTSW 5 43,845,608 (GRCm39) splice site probably null
R0243:Cc2d2a UTSW 5 43,853,980 (GRCm39) splice site probably benign
R0317:Cc2d2a UTSW 5 43,864,243 (GRCm39) critical splice donor site probably null
R0453:Cc2d2a UTSW 5 43,860,636 (GRCm39) missense probably benign 0.00
R0558:Cc2d2a UTSW 5 43,881,729 (GRCm39) splice site probably benign
R0624:Cc2d2a UTSW 5 43,887,371 (GRCm39) missense probably benign
R0634:Cc2d2a UTSW 5 43,838,723 (GRCm39) splice site probably benign
R1503:Cc2d2a UTSW 5 43,852,581 (GRCm39) missense probably damaging 1.00
R1635:Cc2d2a UTSW 5 43,879,812 (GRCm39) missense probably damaging 1.00
R1686:Cc2d2a UTSW 5 43,896,713 (GRCm39) missense possibly damaging 0.81
R1707:Cc2d2a UTSW 5 43,881,030 (GRCm39) splice site probably null
R1715:Cc2d2a UTSW 5 43,876,003 (GRCm39) missense probably damaging 0.97
R1765:Cc2d2a UTSW 5 43,871,873 (GRCm39) missense probably damaging 0.99
R1794:Cc2d2a UTSW 5 43,845,594 (GRCm39) missense probably damaging 1.00
R1881:Cc2d2a UTSW 5 43,898,170 (GRCm39) missense probably damaging 0.99
R1917:Cc2d2a UTSW 5 43,863,564 (GRCm39) missense probably damaging 1.00
R2005:Cc2d2a UTSW 5 43,883,715 (GRCm39) critical splice donor site probably null
R2201:Cc2d2a UTSW 5 43,841,375 (GRCm39) splice site probably benign
R2244:Cc2d2a UTSW 5 43,889,775 (GRCm39) missense probably damaging 1.00
R2368:Cc2d2a UTSW 5 43,861,230 (GRCm39) missense probably benign
R2442:Cc2d2a UTSW 5 43,828,647 (GRCm39) critical splice donor site probably null
R2511:Cc2d2a UTSW 5 43,892,737 (GRCm39) missense probably damaging 0.99
R3023:Cc2d2a UTSW 5 43,842,593 (GRCm39) splice site probably null
R3147:Cc2d2a UTSW 5 43,866,497 (GRCm39) missense probably damaging 1.00
R3148:Cc2d2a UTSW 5 43,866,497 (GRCm39) missense probably damaging 1.00
R3426:Cc2d2a UTSW 5 43,893,451 (GRCm39) missense probably benign 0.00
R3609:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3610:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3611:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3839:Cc2d2a UTSW 5 43,876,056 (GRCm39) missense probably benign
R3870:Cc2d2a UTSW 5 43,876,033 (GRCm39) nonsense probably null
R4334:Cc2d2a UTSW 5 43,840,476 (GRCm39) missense probably benign 0.00
R4913:Cc2d2a UTSW 5 43,896,665 (GRCm39) missense probably benign 0.12
R5179:Cc2d2a UTSW 5 43,845,563 (GRCm39) missense possibly damaging 0.82
R5315:Cc2d2a UTSW 5 43,877,775 (GRCm39) missense probably damaging 0.99
R5352:Cc2d2a UTSW 5 43,863,555 (GRCm39) missense probably damaging 1.00
R5386:Cc2d2a UTSW 5 43,887,383 (GRCm39) missense probably benign 0.01
R5538:Cc2d2a UTSW 5 43,852,518 (GRCm39) missense possibly damaging 0.94
R5568:Cc2d2a UTSW 5 43,866,433 (GRCm39) missense probably damaging 0.99
R5618:Cc2d2a UTSW 5 43,887,249 (GRCm39) missense probably benign 0.00
R5653:Cc2d2a UTSW 5 43,879,804 (GRCm39) missense possibly damaging 0.81
R5817:Cc2d2a UTSW 5 43,869,760 (GRCm39) missense probably damaging 1.00
R5858:Cc2d2a UTSW 5 43,873,117 (GRCm39) missense probably damaging 1.00
R5905:Cc2d2a UTSW 5 43,869,768 (GRCm39) missense probably benign
R5912:Cc2d2a UTSW 5 43,877,772 (GRCm39) missense probably damaging 0.97
R6073:Cc2d2a UTSW 5 43,887,317 (GRCm39) missense probably damaging 1.00
R6084:Cc2d2a UTSW 5 43,826,015 (GRCm39) missense probably benign
R6142:Cc2d2a UTSW 5 43,860,540 (GRCm39) missense probably damaging 0.97
R6176:Cc2d2a UTSW 5 43,866,455 (GRCm39) missense probably benign 0.32
R6238:Cc2d2a UTSW 5 43,828,577 (GRCm39) missense probably benign 0.11
R6381:Cc2d2a UTSW 5 43,873,118 (GRCm39) missense possibly damaging 0.69
R6404:Cc2d2a UTSW 5 43,861,416 (GRCm39) missense possibly damaging 0.58
R6455:Cc2d2a UTSW 5 43,896,754 (GRCm39) missense possibly damaging 0.69
R6695:Cc2d2a UTSW 5 43,876,019 (GRCm39) missense probably damaging 0.99
R6919:Cc2d2a UTSW 5 43,860,557 (GRCm39) missense probably benign 0.19
R6970:Cc2d2a UTSW 5 43,875,927 (GRCm39) missense probably damaging 1.00
R7024:Cc2d2a UTSW 5 43,891,271 (GRCm39) missense probably benign 0.10
R7054:Cc2d2a UTSW 5 43,857,321 (GRCm39) nonsense probably null
R7071:Cc2d2a UTSW 5 43,866,455 (GRCm39) missense probably benign 0.13
R7098:Cc2d2a UTSW 5 43,840,481 (GRCm39) missense probably benign 0.00
R7366:Cc2d2a UTSW 5 43,887,332 (GRCm39) missense probably damaging 1.00
R7908:Cc2d2a UTSW 5 43,864,188 (GRCm39) missense probably benign 0.00
R7920:Cc2d2a UTSW 5 43,896,651 (GRCm39) missense probably benign 0.09
R7950:Cc2d2a UTSW 5 43,852,638 (GRCm39) critical splice donor site probably null
R8007:Cc2d2a UTSW 5 43,863,442 (GRCm39) missense possibly damaging 0.71
R8117:Cc2d2a UTSW 5 43,869,781 (GRCm39) missense probably damaging 1.00
R8123:Cc2d2a UTSW 5 43,867,896 (GRCm39) missense probably benign
R8179:Cc2d2a UTSW 5 43,857,295 (GRCm39) missense probably damaging 0.96
R8279:Cc2d2a UTSW 5 43,893,487 (GRCm39) missense probably benign 0.01
R8293:Cc2d2a UTSW 5 43,845,570 (GRCm39) missense probably damaging 0.97
R8480:Cc2d2a UTSW 5 43,842,486 (GRCm39) splice site probably null
R8482:Cc2d2a UTSW 5 43,852,581 (GRCm39) missense probably damaging 1.00
R8731:Cc2d2a UTSW 5 43,892,788 (GRCm39) missense probably damaging 1.00
R8780:Cc2d2a UTSW 5 43,896,692 (GRCm39) missense probably damaging 1.00
R8784:Cc2d2a UTSW 5 43,860,645 (GRCm39) missense possibly damaging 0.90
R8871:Cc2d2a UTSW 5 43,857,285 (GRCm39) missense possibly damaging 0.71
R8972:Cc2d2a UTSW 5 43,867,884 (GRCm39) missense probably benign
R9122:Cc2d2a UTSW 5 43,831,081 (GRCm39) missense probably null 0.07
R9125:Cc2d2a UTSW 5 43,860,563 (GRCm39) missense probably benign
R9203:Cc2d2a UTSW 5 43,891,179 (GRCm39) missense probably benign 0.01
R9310:Cc2d2a UTSW 5 43,852,488 (GRCm39) missense probably damaging 1.00
R9343:Cc2d2a UTSW 5 43,875,999 (GRCm39) missense probably damaging 1.00
R9353:Cc2d2a UTSW 5 43,860,691 (GRCm39) critical splice donor site probably null
Z1177:Cc2d2a UTSW 5 43,860,546 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGGCCTTAGCATTGTGGC -3'
(R):5'- GAAGGATGACCACCACTTTTCAG -3'

Sequencing Primer
(F):5'- GGCCTGTTTGCTTATACGCAGC -3'
(R):5'- AGTGCAATGTTCATCTTCCCCAATG -3'
Posted On 2018-09-12