Incidental Mutation 'R6805:Dspp'
ID 533526
Institutional Source Beutler Lab
Gene Symbol Dspp
Ensembl Gene ENSMUSG00000053268
Gene Name dentin sialophosphoprotein
Synonyms Dmp3, Dsp, Dpp
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6805 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 104170712-104180127 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 104175850 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 286 (H286Q)
Ref Sequence ENSEMBL: ENSMUSP00000108391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112771]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000112771
AA Change: H286Q

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000108391
Gene: ENSMUSG00000053268
AA Change: H286Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 52 67 N/A INTRINSIC
internal_repeat_1 82 245 2.01e-11 PROSPERO
low complexity region 247 268 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
internal_repeat_1 285 438 2.01e-11 PROSPERO
internal_repeat_2 286 369 2.15e-10 PROSPERO
internal_repeat_2 370 454 2.15e-10 PROSPERO
low complexity region 456 472 N/A INTRINSIC
low complexity region 481 944 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: This gene encodes a member of the small integrin-binding ligand N-linked glycoprotein (SIBLING) family of proteins. The encoded preproprotein is secreted by odontoblasts and proteolytically processed to generate two principal proteins of the dentin extracellular matrix of the tooth, dentin sialoprotein and dentin phosphoprotein. These two protein products may play distinct but related roles in dentin mineralization. Mice lacking the encoded protein exhibit hypomineralization defects in dentin, similar to human dentinogenesis imperfecta. [provided by RefSeq, Feb 2016]
PHENOTYPE: Aging mice homozygous for a reporter/null allele display tooth abnormalities, including enlarged pulp cavities, a widened predentin zone, dentin hypomineralization, pulp exposure, and occasional brittle incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,306 V2591A probably benign Het
4930407I10Rik A G 15: 82,062,543 T214A possibly damaging Het
A930009A15Rik G T 10: 115,579,905 probably benign Het
Aadac A C 3: 60,037,336 D143A probably benign Het
Acot10 T G 15: 20,665,366 T430P probably benign Het
Adgrb3 T C 1: 25,826,172 T197A possibly damaging Het
B230118H07Rik T C 2: 101,566,459 K192E probably benign Het
Bbs1 A G 19: 4,900,615 I200T probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cadps G A 14: 12,467,103 A943V probably damaging Het
Cc2d2a A G 5: 43,681,331 E48G probably damaging Het
Clca1 A T 3: 145,018,667 C211S probably damaging Het
Col18a1 A G 10: 77,054,239 L1429P probably damaging Het
Cul2 T G 18: 3,421,263 Y196D probably damaging Het
D630023F18Rik T C 1: 65,117,206 S43G probably benign Het
Ddx39 G A 8: 83,723,137 R427Q probably damaging Het
Def6 A G 17: 28,223,717 T285A probably damaging Het
Defb21 T A 2: 152,574,869 D88E probably benign Het
Defb6 A G 8: 19,228,101 K63R probably benign Het
Dnph1 T C 17: 46,498,744 S112P probably damaging Het
Dock10 T A 1: 80,586,690 I467L probably benign Het
Eya1 T A 1: 14,183,277 T459S probably benign Het
Faf1 T C 4: 109,861,852 L385P probably damaging Het
Fbxw21 C A 9: 109,157,565 R82L probably damaging Het
Fryl A G 5: 73,065,094 V2048A probably benign Het
Galnt5 A T 2: 58,035,299 D864V possibly damaging Het
Gata6 T G 18: 11,054,460 S130A possibly damaging Het
Gbf1 G T 19: 46,262,507 R434L probably damaging Het
Gga3 A G 11: 115,585,762 F709L probably damaging Het
Hcar1 A G 5: 123,879,130 V166A probably benign Het
Hexa T A 9: 59,563,937 N491K possibly damaging Het
Hpse2 A T 19: 43,294,321 C164* probably null Het
Ifi202b T C 1: 173,974,989 Y93C probably damaging Het
Iscu T A 5: 113,775,243 I79N probably damaging Het
Jmjd7 T A 2: 120,031,323 Y182* probably null Het
Jup A T 11: 100,383,458 D135E probably benign Het
Kit T A 5: 75,652,808 I881N probably damaging Het
Llgl1 T A 11: 60,702,865 S55T probably benign Het
Lonp2 G A 8: 86,709,096 M653I probably benign Het
Lrp8 T C 4: 107,854,320 Y307H probably damaging Het
Med13 A T 11: 86,278,796 M1914K possibly damaging Het
Ms4a1 A G 19: 11,253,173 probably null Het
Naip1 A G 13: 100,427,341 S439P probably benign Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1129 T A 2: 87,574,918 probably null Het
Olfr835 G T 9: 19,035,301 M59I probably damaging Het
Pds5b T A 5: 150,805,561 probably null Het
Phf12 G A 11: 78,027,373 G804R probably damaging Het
Pou6f2 T C 13: 18,239,489 T234A Het
Prune2 A T 19: 17,120,590 I1153L probably benign Het
Ptprc C T 1: 138,067,885 probably null Het
Qpctl T C 7: 19,149,154 Q11R probably benign Het
Rfx4 A G 10: 84,840,228 K103E possibly damaging Het
Srcin1 T A 11: 97,551,980 probably null Het
St6galnac1 G T 11: 116,768,944 A181D probably damaging Het
Stk36 T C 1: 74,622,239 V475A probably benign Het
Tbc1d21 T C 9: 58,361,288 T263A possibly damaging Het
Tex24 A T 8: 27,345,000 K185N probably damaging Het
Tnxb T A 17: 34,698,153 V2174E possibly damaging Het
Tollip A G 7: 141,890,845 S57P probably benign Het
Zbtb49 A G 5: 38,213,241 probably benign Het
Zfp758 A G 17: 22,361,669 T30A probably benign Het
Other mutations in Dspp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Dspp APN 5 104176892 missense possibly damaging 0.95
IGL01096:Dspp APN 5 104175367 missense possibly damaging 0.92
IGL01317:Dspp APN 5 104174048 missense probably damaging 0.99
IGL02365:Dspp APN 5 104176061 missense probably damaging 1.00
IGL02387:Dspp APN 5 104175624 missense possibly damaging 0.82
IGL02406:Dspp APN 5 104177366 nonsense probably null
IGL02445:Dspp APN 5 104177097 missense probably damaging 0.99
IGL02481:Dspp APN 5 104175648 missense possibly damaging 0.94
IGL02536:Dspp APN 5 104175665 missense probably damaging 0.99
IGL02572:Dspp APN 5 104177069 missense probably damaging 0.99
IGL02677:Dspp APN 5 104175977 missense possibly damaging 0.78
IGL02709:Dspp APN 5 104177250 missense unknown
IGL02723:Dspp APN 5 104175175 missense probably benign 0.03
IGL02740:Dspp APN 5 104177238 nonsense probably null
IGL03274:Dspp APN 5 104174948 missense probably damaging 0.99
IGL03293:Dspp APN 5 104177561 missense unknown
FR4449:Dspp UTSW 5 104178388 small deletion probably benign
R0018:Dspp UTSW 5 104178230 missense unknown
R0125:Dspp UTSW 5 104178039 missense unknown
R0503:Dspp UTSW 5 104177256 missense unknown
R1709:Dspp UTSW 5 104175724 missense probably damaging 0.98
R1851:Dspp UTSW 5 104174085 critical splice donor site probably null
R2001:Dspp UTSW 5 104178559 missense unknown
R2002:Dspp UTSW 5 104178559 missense unknown
R2198:Dspp UTSW 5 104175701 missense probably benign 0.37
R2279:Dspp UTSW 5 104178384 missense unknown
R4026:Dspp UTSW 5 104177697 missense unknown
R4066:Dspp UTSW 5 104177194 missense unknown
R4632:Dspp UTSW 5 104177406 missense unknown
R4693:Dspp UTSW 5 104178062 missense unknown
R4841:Dspp UTSW 5 104177186 missense unknown
R4841:Dspp UTSW 5 104177187 missense unknown
R4917:Dspp UTSW 5 104177923 missense unknown
R5008:Dspp UTSW 5 104175573 missense possibly damaging 0.66
R5015:Dspp UTSW 5 104177060 missense possibly damaging 0.46
R5214:Dspp UTSW 5 104178498 missense unknown
R5359:Dspp UTSW 5 104175886 missense probably damaging 0.98
R5538:Dspp UTSW 5 104175230 nonsense probably null
R5703:Dspp UTSW 5 104177051 missense possibly damaging 0.82
R5887:Dspp UTSW 5 104175455 missense probably damaging 1.00
R5902:Dspp UTSW 5 104178111 missense unknown
R5992:Dspp UTSW 5 104178451 missense unknown
R6019:Dspp UTSW 5 104178039 missense unknown
R6191:Dspp UTSW 5 104177348 missense unknown
R6362:Dspp UTSW 5 104176034 missense probably benign 0.19
R6736:Dspp UTSW 5 104178175 missense unknown
R7064:Dspp UTSW 5 104176938 missense possibly damaging 0.73
R7178:Dspp UTSW 5 104174066 missense probably benign 0.02
R7243:Dspp UTSW 5 104178361 small deletion probably benign
R7390:Dspp UTSW 5 104175686 missense probably damaging 0.98
R7454:Dspp UTSW 5 104175610 missense probably benign 0.01
R7585:Dspp UTSW 5 104175525 missense possibly damaging 0.90
R7662:Dspp UTSW 5 104177870 missense unknown
R7739:Dspp UTSW 5 104178146 missense unknown
R7755:Dspp UTSW 5 104178361 small deletion probably benign
R7805:Dspp UTSW 5 104175393 missense probably damaging 0.99
R7869:Dspp UTSW 5 104175665 missense probably damaging 0.99
R7945:Dspp UTSW 5 104178361 small deletion probably benign
R7978:Dspp UTSW 5 104178361 small deletion probably benign
R8088:Dspp UTSW 5 104177256 missense unknown
R8254:Dspp UTSW 5 104175328 missense possibly damaging 0.94
R8257:Dspp UTSW 5 104177001 missense probably benign 0.01
R8439:Dspp UTSW 5 104177296 missense unknown
R8486:Dspp UTSW 5 104174017 start gained probably benign
R8722:Dspp UTSW 5 104178567 missense unknown
R8969:Dspp UTSW 5 104177774 missense unknown
R9254:Dspp UTSW 5 104174894 critical splice acceptor site probably null
R9379:Dspp UTSW 5 104174894 critical splice acceptor site probably null
RF007:Dspp UTSW 5 104178361 small deletion probably benign
RF044:Dspp UTSW 5 104178424 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGAGGTGACACCAAGCATCG -3'
(R):5'- GAAGGACATGCTTCTGACTGGC -3'

Sequencing Primer
(F):5'- CATCGGGGAAGATGCAGGTTTG -3'
(R):5'- TGACTGGCTGATGATCCCAC -3'
Posted On 2018-09-12