Mutagenetix > Incidental Mutation

Incidental Mutation 'R6805:Dspp'

533526

Institutional Source

Beutler Lab

Gene Symbol

Dspp

Ensembl Gene

ENSMUSG00000053268

Gene Name

dentin sialophosphoprotein

Synonyms

Dmp3, Dsp, Dpp

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6805 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104170712-104180127 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 104175850 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 286 (H286Q)

Ref Sequence

ENSEMBL: ENSMUSP00000108391 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112771]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000112771
AA Change: H286Q

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000108391
Gene: ENSMUSG00000053268
AA Change: H286Q

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
low complexity region	52	67	N/A	INTRINSIC
internal_repeat_1	82	245	2.01e-11	PROSPERO
low complexity region	247	268	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
internal_repeat_1	285	438	2.01e-11	PROSPERO
internal_repeat_2	286	369	2.15e-10	PROSPERO
internal_repeat_2	370	454	2.15e-10	PROSPERO
low complexity region	456	472	N/A	INTRINSIC
low complexity region	481	944	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.8%
20x: 97.1%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: This gene encodes a member of the small integrin-binding ligand N-linked glycoprotein (SIBLING) family of proteins. The encoded preproprotein is secreted by odontoblasts and proteolytically processed to generate two principal proteins of the dentin extracellular matrix of the tooth, dentin sialoprotein and dentin phosphoprotein. These two protein products may play distinct but related roles in dentin mineralization. Mice lacking the encoded protein exhibit hypomineralization defects in dentin, similar to human dentinogenesis imperfecta. [provided by RefSeq, Feb 2016]
PHENOTYPE: Aging mice homozygous for a reporter/null allele display tooth abnormalities, including enlarged pulp cavities, a widened predentin zone, dentin hypomineralization, pulp exposure, and occasional brittle incisors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,244,306	V2591A	probably benign	Het
4930407I10Rik	A	G	15: 82,062,543	T214A	possibly damaging	Het
A930009A15Rik	G	T	10: 115,579,905		probably benign	Het
Aadac	A	C	3: 60,037,336	D143A	probably benign	Het
Acot10	T	G	15: 20,665,366	T430P	probably benign	Het
Adgrb3	T	C	1: 25,826,172	T197A	possibly damaging	Het
B230118H07Rik	T	C	2: 101,566,459	K192E	probably benign	Het
Bbs1	A	G	19: 4,900,615	I200T	probably damaging	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
Cadps	G	A	14: 12,467,103	A943V	probably damaging	Het
Cc2d2a	A	G	5: 43,681,331	E48G	probably damaging	Het
Clca1	A	T	3: 145,018,667	C211S	probably damaging	Het
Col18a1	A	G	10: 77,054,239	L1429P	probably damaging	Het
Cul2	T	G	18: 3,421,263	Y196D	probably damaging	Het
D630023F18Rik	T	C	1: 65,117,206	S43G	probably benign	Het
Ddx39	G	A	8: 83,723,137	R427Q	probably damaging	Het
Def6	A	G	17: 28,223,717	T285A	probably damaging	Het
Defb21	T	A	2: 152,574,869	D88E	probably benign	Het
Defb6	A	G	8: 19,228,101	K63R	probably benign	Het
Dnph1	T	C	17: 46,498,744	S112P	probably damaging	Het
Dock10	T	A	1: 80,586,690	I467L	probably benign	Het
Eya1	T	A	1: 14,183,277	T459S	probably benign	Het
Faf1	T	C	4: 109,861,852	L385P	probably damaging	Het
Fbxw21	C	A	9: 109,157,565	R82L	probably damaging	Het
Fryl	A	G	5: 73,065,094	V2048A	probably benign	Het
Galnt5	A	T	2: 58,035,299	D864V	possibly damaging	Het
Gata6	T	G	18: 11,054,460	S130A	possibly damaging	Het
Gbf1	G	T	19: 46,262,507	R434L	probably damaging	Het
Gga3	A	G	11: 115,585,762	F709L	probably damaging	Het
Hcar1	A	G	5: 123,879,130	V166A	probably benign	Het
Hexa	T	A	9: 59,563,937	N491K	possibly damaging	Het
Hpse2	A	T	19: 43,294,321	C164*	probably null	Het
Ifi202b	T	C	1: 173,974,989	Y93C	probably damaging	Het
Iscu	T	A	5: 113,775,243	I79N	probably damaging	Het
Jmjd7	T	A	2: 120,031,323	Y182*	probably null	Het
Jup	A	T	11: 100,383,458	D135E	probably benign	Het
Kit	T	A	5: 75,652,808	I881N	probably damaging	Het
Llgl1	T	A	11: 60,702,865	S55T	probably benign	Het
Lonp2	G	A	8: 86,709,096	M653I	probably benign	Het
Lrp8	T	C	4: 107,854,320	Y307H	probably damaging	Het
Med13	A	T	11: 86,278,796	M1914K	possibly damaging	Het
Ms4a1	A	G	19: 11,253,173		probably null	Het
Naip1	A	G	13: 100,427,341	S439P	probably benign	Het
Nrg1	T	C	8: 31,821,264	R476G	probably damaging	Het
Olfr1129	T	A	2: 87,574,918		probably null	Het
Olfr835	G	T	9: 19,035,301	M59I	probably damaging	Het
Pds5b	T	A	5: 150,805,561		probably null	Het
Phf12	G	A	11: 78,027,373	G804R	probably damaging	Het
Pou6f2	T	C	13: 18,239,489	T234A		Het
Prune2	A	T	19: 17,120,590	I1153L	probably benign	Het
Ptprc	C	T	1: 138,067,885		probably null	Het
Qpctl	T	C	7: 19,149,154	Q11R	probably benign	Het
Rfx4	A	G	10: 84,840,228	K103E	possibly damaging	Het
Srcin1	T	A	11: 97,551,980		probably null	Het
St6galnac1	G	T	11: 116,768,944	A181D	probably damaging	Het
Stk36	T	C	1: 74,622,239	V475A	probably benign	Het
Tbc1d21	T	C	9: 58,361,288	T263A	possibly damaging	Het
Tex24	A	T	8: 27,345,000	K185N	probably damaging	Het
Tnxb	T	A	17: 34,698,153	V2174E	possibly damaging	Het
Tollip	A	G	7: 141,890,845	S57P	probably benign	Het
Zbtb49	A	G	5: 38,213,241		probably benign	Het
Zfp758	A	G	17: 22,361,669	T30A	probably benign	Het

Other mutations in Dspp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00973:Dspp	APN	5	104176892	missense	possibly damaging	0.95
IGL01096:Dspp	APN	5	104175367	missense	possibly damaging	0.92
IGL01317:Dspp	APN	5	104174048	missense	probably damaging	0.99
IGL02365:Dspp	APN	5	104176061	missense	probably damaging	1.00
IGL02387:Dspp	APN	5	104175624	missense	possibly damaging	0.82
IGL02406:Dspp	APN	5	104177366	nonsense	probably null
IGL02445:Dspp	APN	5	104177097	missense	probably damaging	0.99
IGL02481:Dspp	APN	5	104175648	missense	possibly damaging	0.94
IGL02536:Dspp	APN	5	104175665	missense	probably damaging	0.99
IGL02572:Dspp	APN	5	104177069	missense	probably damaging	0.99
IGL02677:Dspp	APN	5	104175977	missense	possibly damaging	0.78
IGL02709:Dspp	APN	5	104177250	missense	unknown
IGL02723:Dspp	APN	5	104175175	missense	probably benign	0.03
IGL02740:Dspp	APN	5	104177238	nonsense	probably null
IGL03274:Dspp	APN	5	104174948	missense	probably damaging	0.99
IGL03293:Dspp	APN	5	104177561	missense	unknown
FR4449:Dspp	UTSW	5	104178388	small deletion	probably benign
R0018:Dspp	UTSW	5	104178230	missense	unknown
R0125:Dspp	UTSW	5	104178039	missense	unknown
R0503:Dspp	UTSW	5	104177256	missense	unknown
R1709:Dspp	UTSW	5	104175724	missense	probably damaging	0.98
R1851:Dspp	UTSW	5	104174085	critical splice donor site	probably null
R2001:Dspp	UTSW	5	104178559	missense	unknown
R2002:Dspp	UTSW	5	104178559	missense	unknown
R2198:Dspp	UTSW	5	104175701	missense	probably benign	0.37
R2279:Dspp	UTSW	5	104178384	missense	unknown
R4026:Dspp	UTSW	5	104177697	missense	unknown
R4066:Dspp	UTSW	5	104177194	missense	unknown
R4632:Dspp	UTSW	5	104177406	missense	unknown
R4693:Dspp	UTSW	5	104178062	missense	unknown
R4841:Dspp	UTSW	5	104177186	missense	unknown
R4841:Dspp	UTSW	5	104177187	missense	unknown
R4917:Dspp	UTSW	5	104177923	missense	unknown
R5008:Dspp	UTSW	5	104175573	missense	possibly damaging	0.66
R5015:Dspp	UTSW	5	104177060	missense	possibly damaging	0.46
R5214:Dspp	UTSW	5	104178498	missense	unknown
R5359:Dspp	UTSW	5	104175886	missense	probably damaging	0.98
R5538:Dspp	UTSW	5	104175230	nonsense	probably null
R5703:Dspp	UTSW	5	104177051	missense	possibly damaging	0.82
R5887:Dspp	UTSW	5	104175455	missense	probably damaging	1.00
R5902:Dspp	UTSW	5	104178111	missense	unknown
R5992:Dspp	UTSW	5	104178451	missense	unknown
R6019:Dspp	UTSW	5	104178039	missense	unknown
R6191:Dspp	UTSW	5	104177348	missense	unknown
R6362:Dspp	UTSW	5	104176034	missense	probably benign	0.19
R6736:Dspp	UTSW	5	104178175	missense	unknown
R7064:Dspp	UTSW	5	104176938	missense	possibly damaging	0.73
R7178:Dspp	UTSW	5	104174066	missense	probably benign	0.02
R7243:Dspp	UTSW	5	104178361	small deletion	probably benign
R7390:Dspp	UTSW	5	104175686	missense	probably damaging	0.98
R7454:Dspp	UTSW	5	104175610	missense	probably benign	0.01
R7585:Dspp	UTSW	5	104175525	missense	possibly damaging	0.90
R7662:Dspp	UTSW	5	104177870	missense	unknown
R7739:Dspp	UTSW	5	104178146	missense	unknown
R7755:Dspp	UTSW	5	104178361	small deletion	probably benign
R7805:Dspp	UTSW	5	104175393	missense	probably damaging	0.99
R7869:Dspp	UTSW	5	104175665	missense	probably damaging	0.99
R7945:Dspp	UTSW	5	104178361	small deletion	probably benign
R7978:Dspp	UTSW	5	104178361	small deletion	probably benign
R8088:Dspp	UTSW	5	104177256	missense	unknown
R8254:Dspp	UTSW	5	104175328	missense	possibly damaging	0.94
R8257:Dspp	UTSW	5	104177001	missense	probably benign	0.01
R8439:Dspp	UTSW	5	104177296	missense	unknown
R8486:Dspp	UTSW	5	104174017	start gained	probably benign
R8722:Dspp	UTSW	5	104178567	missense	unknown
R8969:Dspp	UTSW	5	104177774	missense	unknown
R9254:Dspp	UTSW	5	104174894	critical splice acceptor site	probably null
R9379:Dspp	UTSW	5	104174894	critical splice acceptor site	probably null
R9509:Dspp	UTSW	5	104177791	missense	unknown
R9647:Dspp	UTSW	5	104175770	missense	possibly damaging	0.89
RF007:Dspp	UTSW	5	104178361	small deletion	probably benign
RF044:Dspp	UTSW	5	104178424	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- TGAGGTGACACCAAGCATCG -3'
(R):5'- GAAGGACATGCTTCTGACTGGC -3'

Sequencing Primer
(F):5'- CATCGGGGAAGATGCAGGTTTG -3'
(R):5'- TGACTGGCTGATGATCCCAC -3'

Posted On

2018-09-12