Mutagenetix > Incidental Mutation

Incidental Mutation 'R6805:Pds5b'

533529

Institutional Source

Beutler Lab

Gene Symbol

Pds5b

Ensembl Gene

ENSMUSG00000034021

Gene Name

PDS5 cohesin associated factor B

Synonyms

Aprin, AS3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6805 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

150673739-150810690 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 150805561 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000144572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016569] [ENSMUST00000038900] [ENSMUST00000202170]

AlphaFold

Q4VA53

Predicted Effect

probably null
Transcript: ENSMUST00000016569

SMART Domains

Protein: ENSMUSP00000016569
Gene: ENSMUSG00000034021

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	244	773	6e-33	SMART
low complexity region	1156	1167	N/A	INTRINSIC
AT_hook	1247	1259	4.14e1	SMART
AT_hook	1285	1297	1.35e2	SMART
low complexity region	1307	1316	N/A	INTRINSIC
low complexity region	1318	1329	N/A	INTRINSIC
AT_hook	1370	1382	1.46e0	SMART
low complexity region	1437	1446	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000038900

SMART Domains

Protein: ENSMUSP00000038421
Gene: ENSMUSG00000034021

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	244	773	6e-33	SMART
low complexity region	1156	1167	N/A	INTRINSIC
AT_hook	1249	1261	4.14e1	SMART
AT_hook	1287	1299	1.35e2	SMART
low complexity region	1309	1318	N/A	INTRINSIC
low complexity region	1320	1331	N/A	INTRINSIC
AT_hook	1373	1385	1.46e0	SMART
low complexity region	1440	1449	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000202170

SMART Domains

Protein: ENSMUSP00000144572
Gene: ENSMUSG00000034021

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	244	773	6e-33	SMART
low complexity region	1156	1167	N/A	INTRINSIC
AT_hook	1249	1261	4.14e1	SMART
AT_hook	1287	1299	1.35e2	SMART
low complexity region	1309	1318	N/A	INTRINSIC
low complexity region	1320	1331	N/A	INTRINSIC
AT_hook	1372	1384	1.46e0	SMART
low complexity region	1439	1448	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.8%
20x: 97.1%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the conserved protein complex termed cohesin. The cohesin complex holds together sister chromatids and facilitates accurate chromosome segregation during mitosis and meiosis. This protein is also a negative regulator of cell proliferation and may be a tumor-suppressor gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality with cardiac defects, craniofacial abnormalities, axial skeletal defects, shortening of most of the long bones, abnormal enteric nervous system morphology, and decreased germ cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,244,306	V2591A	probably benign	Het
4930407I10Rik	A	G	15: 82,062,543	T214A	possibly damaging	Het
A930009A15Rik	G	T	10: 115,579,905		probably benign	Het
Aadac	A	C	3: 60,037,336	D143A	probably benign	Het
Acot10	T	G	15: 20,665,366	T430P	probably benign	Het
Adgrb3	T	C	1: 25,826,172	T197A	possibly damaging	Het
B230118H07Rik	T	C	2: 101,566,459	K192E	probably benign	Het
Bbs1	A	G	19: 4,900,615	I200T	probably damaging	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
Cadps	G	A	14: 12,467,103	A943V	probably damaging	Het
Cc2d2a	A	G	5: 43,681,331	E48G	probably damaging	Het
Clca1	A	T	3: 145,018,667	C211S	probably damaging	Het
Col18a1	A	G	10: 77,054,239	L1429P	probably damaging	Het
Cul2	T	G	18: 3,421,263	Y196D	probably damaging	Het
D630023F18Rik	T	C	1: 65,117,206	S43G	probably benign	Het
Ddx39	G	A	8: 83,723,137	R427Q	probably damaging	Het
Def6	A	G	17: 28,223,717	T285A	probably damaging	Het
Defb21	T	A	2: 152,574,869	D88E	probably benign	Het
Defb6	A	G	8: 19,228,101	K63R	probably benign	Het
Dnph1	T	C	17: 46,498,744	S112P	probably damaging	Het
Dock10	T	A	1: 80,586,690	I467L	probably benign	Het
Dspp	C	A	5: 104,175,850	H286Q	probably benign	Het
Eya1	T	A	1: 14,183,277	T459S	probably benign	Het
Faf1	T	C	4: 109,861,852	L385P	probably damaging	Het
Fbxw21	C	A	9: 109,157,565	R82L	probably damaging	Het
Fryl	A	G	5: 73,065,094	V2048A	probably benign	Het
Galnt5	A	T	2: 58,035,299	D864V	possibly damaging	Het
Gata6	T	G	18: 11,054,460	S130A	possibly damaging	Het
Gbf1	G	T	19: 46,262,507	R434L	probably damaging	Het
Gga3	A	G	11: 115,585,762	F709L	probably damaging	Het
Hcar1	A	G	5: 123,879,130	V166A	probably benign	Het
Hexa	T	A	9: 59,563,937	N491K	possibly damaging	Het
Hpse2	A	T	19: 43,294,321	C164*	probably null	Het
Ifi202b	T	C	1: 173,974,989	Y93C	probably damaging	Het
Iscu	T	A	5: 113,775,243	I79N	probably damaging	Het
Jmjd7	T	A	2: 120,031,323	Y182*	probably null	Het
Jup	A	T	11: 100,383,458	D135E	probably benign	Het
Kit	T	A	5: 75,652,808	I881N	probably damaging	Het
Llgl1	T	A	11: 60,702,865	S55T	probably benign	Het
Lonp2	G	A	8: 86,709,096	M653I	probably benign	Het
Lrp8	T	C	4: 107,854,320	Y307H	probably damaging	Het
Med13	A	T	11: 86,278,796	M1914K	possibly damaging	Het
Ms4a1	A	G	19: 11,253,173		probably null	Het
Naip1	A	G	13: 100,427,341	S439P	probably benign	Het
Nrg1	T	C	8: 31,821,264	R476G	probably damaging	Het
Olfr1129	T	A	2: 87,574,918		probably null	Het
Olfr835	G	T	9: 19,035,301	M59I	probably damaging	Het
Phf12	G	A	11: 78,027,373	G804R	probably damaging	Het
Pou6f2	T	C	13: 18,239,489	T234A		Het
Prune2	A	T	19: 17,120,590	I1153L	probably benign	Het
Ptprc	C	T	1: 138,067,885		probably null	Het
Qpctl	T	C	7: 19,149,154	Q11R	probably benign	Het
Rfx4	A	G	10: 84,840,228	K103E	possibly damaging	Het
Srcin1	T	A	11: 97,551,980		probably null	Het
St6galnac1	G	T	11: 116,768,944	A181D	probably damaging	Het
Stk36	T	C	1: 74,622,239	V475A	probably benign	Het
Tbc1d21	T	C	9: 58,361,288	T263A	possibly damaging	Het
Tex24	A	T	8: 27,345,000	K185N	probably damaging	Het
Tnxb	T	A	17: 34,698,153	V2174E	possibly damaging	Het
Tollip	A	G	7: 141,890,845	S57P	probably benign	Het
Zbtb49	A	G	5: 38,213,241		probably benign	Het
Zfp758	A	G	17: 22,361,669	T30A	probably benign	Het

Other mutations in Pds5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00719:Pds5b	APN	5	150722542	missense	probably benign	0.25
IGL01530:Pds5b	APN	5	150792175	missense	probably benign	0.38
IGL01812:Pds5b	APN	5	150780689	missense	probably damaging	1.00
IGL02163:Pds5b	APN	5	150756406	missense	probably benign	0.00
IGL02730:Pds5b	APN	5	150780752	splice site	probably benign
IGL02825:Pds5b	APN	5	150728970	missense	possibly damaging	0.90
IGL03143:Pds5b	APN	5	150779257	missense	probably damaging	1.00
IGL03379:Pds5b	APN	5	150788331	missense	probably damaging	1.00
PIT4283001:Pds5b	UTSW	5	150778309	missense	probably damaging	0.99
R0026:Pds5b	UTSW	5	150749830	splice site	probably benign
R0197:Pds5b	UTSW	5	150754431	missense	probably benign	0.28
R0347:Pds5b	UTSW	5	150736427	splice site	probably benign
R0396:Pds5b	UTSW	5	150779275	missense	possibly damaging	0.96
R0400:Pds5b	UTSW	5	150723353	missense	possibly damaging	0.46
R0442:Pds5b	UTSW	5	150716544	splice site	probably benign
R0745:Pds5b	UTSW	5	150805671	missense	probably benign
R0839:Pds5b	UTSW	5	150764962	missense	probably benign	0.23
R0866:Pds5b	UTSW	5	150739191	splice site	probably benign
R1247:Pds5b	UTSW	5	150775354	critical splice acceptor site	probably benign
R1330:Pds5b	UTSW	5	150761077	missense	probably damaging	0.97
R1440:Pds5b	UTSW	5	150754417	missense	probably damaging	1.00
R1526:Pds5b	UTSW	5	150716400	splice site	probably null
R2010:Pds5b	UTSW	5	150775354	critical splice acceptor site	probably benign
R2051:Pds5b	UTSW	5	150748190	missense	probably damaging	1.00
R2507:Pds5b	UTSW	5	150756428	missense	possibly damaging	0.90
R3111:Pds5b	UTSW	5	150719907	missense	probably damaging	1.00
R3820:Pds5b	UTSW	5	150736337	missense	possibly damaging	0.94
R3911:Pds5b	UTSW	5	150746706	missense	probably benign	0.41
R4077:Pds5b	UTSW	5	150794359	missense	possibly damaging	0.62
R4118:Pds5b	UTSW	5	150775354	critical splice acceptor site	probably benign
R4342:Pds5b	UTSW	5	150800854	missense	probably benign	0.17
R4416:Pds5b	UTSW	5	150736396	missense	probably damaging	1.00
R4503:Pds5b	UTSW	5	150728934	missense	probably damaging	1.00
R4524:Pds5b	UTSW	5	150788316	missense	probably damaging	1.00
R4579:Pds5b	UTSW	5	150746732	missense	probably damaging	0.98
R4623:Pds5b	UTSW	5	150800601	missense	probably benign	0.37
R4847:Pds5b	UTSW	5	150748112	missense	probably damaging	1.00
R4885:Pds5b	UTSW	5	150716462	missense	probably benign	0.21
R5271:Pds5b	UTSW	5	150723353	missense	possibly damaging	0.46
R5281:Pds5b	UTSW	5	150746608	missense	probably benign	0.26
R5337:Pds5b	UTSW	5	150793597	missense	probably benign	0.03
R5635:Pds5b	UTSW	5	150778221	missense	possibly damaging	0.78
R5677:Pds5b	UTSW	5	150716461	missense	possibly damaging	0.91
R6005:Pds5b	UTSW	5	150769776	splice site	probably null
R6139:Pds5b	UTSW	5	150800777	missense	possibly damaging	0.81
R6225:Pds5b	UTSW	5	150746618	missense	probably damaging	0.98
R6279:Pds5b	UTSW	5	150723248	missense	possibly damaging	0.80
R6300:Pds5b	UTSW	5	150723248	missense	possibly damaging	0.80
R6666:Pds5b	UTSW	5	150778166	missense	probably damaging	1.00
R7038:Pds5b	UTSW	5	150800760	missense	probably benign	0.02
R7046:Pds5b	UTSW	5	150749920	missense	probably damaging	1.00
R7051:Pds5b	UTSW	5	150794282	missense	possibly damaging	0.78
R7138:Pds5b	UTSW	5	150800677	nonsense	probably null
R7255:Pds5b	UTSW	5	150796667	missense	probably benign	0.33
R7467:Pds5b	UTSW	5	150736327	missense	probably damaging	0.99
R7488:Pds5b	UTSW	5	150723337	missense	probably damaging	0.97
R7512:Pds5b	UTSW	5	150788342	missense	probably damaging	1.00
R7561:Pds5b	UTSW	5	150739318	critical splice donor site	probably null
R7576:Pds5b	UTSW	5	150778261	missense	probably damaging	1.00
R7889:Pds5b	UTSW	5	150792172	missense	probably damaging	1.00
R7982:Pds5b	UTSW	5	150769941	missense	probably damaging	1.00
R8059:Pds5b	UTSW	5	150807835	missense	unknown
R8211:Pds5b	UTSW	5	150728942	missense	possibly damaging	0.90
R8412:Pds5b	UTSW	5	150719959	missense	probably damaging	1.00
R8503:Pds5b	UTSW	5	150716507	missense	possibly damaging	0.95
R8556:Pds5b	UTSW	5	150792608	missense	probably benign
R8786:Pds5b	UTSW	5	150780669	missense	probably damaging	1.00
R8929:Pds5b	UTSW	5	150719914	missense	probably damaging	1.00
R8985:Pds5b	UTSW	5	150800774	missense	probably benign	0.38
R9184:Pds5b	UTSW	5	150800784	missense	probably benign	0.04
R9343:Pds5b	UTSW	5	150780721	missense	probably damaging	1.00
R9432:Pds5b	UTSW	5	150769791	missense	probably damaging	1.00
R9571:Pds5b	UTSW	5	150722506	missense	probably damaging	1.00
R9712:Pds5b	UTSW	5	150805663	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- GTGATAGTCTTGGTGGCACC -3'
(R):5'- GGAGCTGACTAAATATTTACTGGC -3'

Sequencing Primer
(F):5'- GAAATGCTTATGGGTCAAATGA -3'
(R):5'- CTGGCTCAATTTTTGCACATACATG -3'

Posted On

2018-09-12