Incidental Mutation 'R6805:C1ra'
ID 533530
Institutional Source Beutler Lab
Gene Symbol C1ra
Ensembl Gene ENSMUSG00000055172
Gene Name complement component 1, r subcomponent A
Synonyms mC1rA
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6805 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 124512405-124523443 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 124517725 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 316 (E316K)
Ref Sequence ENSEMBL: ENSMUSP00000063707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068593]
AlphaFold Q8CG16
Predicted Effect probably benign
Transcript: ENSMUST00000068593
AA Change: E316K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063707
Gene: ENSMUSG00000055172
AA Change: E316K

DomainStartEndE-ValueType
CUB 14 140 1.56e-35 SMART
EGF_CA 141 189 1.88e-10 SMART
CUB 192 304 4.74e-35 SMART
CCP 308 370 5.56e-9 SMART
CCP 375 446 1.53e-6 SMART
Tryp_SPc 462 699 2.7e-71 SMART
Meta Mutation Damage Score 0.0792 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,306 V2591A probably benign Het
4930407I10Rik A G 15: 82,062,543 T214A possibly damaging Het
A930009A15Rik G T 10: 115,579,905 probably benign Het
Aadac A C 3: 60,037,336 D143A probably benign Het
Acot10 T G 15: 20,665,366 T430P probably benign Het
Adgrb3 T C 1: 25,826,172 T197A possibly damaging Het
B230118H07Rik T C 2: 101,566,459 K192E probably benign Het
Bbs1 A G 19: 4,900,615 I200T probably damaging Het
Cadps G A 14: 12,467,103 A943V probably damaging Het
Cc2d2a A G 5: 43,681,331 E48G probably damaging Het
Clca1 A T 3: 145,018,667 C211S probably damaging Het
Col18a1 A G 10: 77,054,239 L1429P probably damaging Het
Cul2 T G 18: 3,421,263 Y196D probably damaging Het
D630023F18Rik T C 1: 65,117,206 S43G probably benign Het
Ddx39 G A 8: 83,723,137 R427Q probably damaging Het
Def6 A G 17: 28,223,717 T285A probably damaging Het
Defb21 T A 2: 152,574,869 D88E probably benign Het
Defb6 A G 8: 19,228,101 K63R probably benign Het
Dnph1 T C 17: 46,498,744 S112P probably damaging Het
Dock10 T A 1: 80,586,690 I467L probably benign Het
Dspp C A 5: 104,175,850 H286Q probably benign Het
Eya1 T A 1: 14,183,277 T459S probably benign Het
Faf1 T C 4: 109,861,852 L385P probably damaging Het
Fbxw21 C A 9: 109,157,565 R82L probably damaging Het
Fryl A G 5: 73,065,094 V2048A probably benign Het
Galnt5 A T 2: 58,035,299 D864V possibly damaging Het
Gata6 T G 18: 11,054,460 S130A possibly damaging Het
Gbf1 G T 19: 46,262,507 R434L probably damaging Het
Gga3 A G 11: 115,585,762 F709L probably damaging Het
Hcar1 A G 5: 123,879,130 V166A probably benign Het
Hexa T A 9: 59,563,937 N491K possibly damaging Het
Hpse2 A T 19: 43,294,321 C164* probably null Het
Ifi202b T C 1: 173,974,989 Y93C probably damaging Het
Iscu T A 5: 113,775,243 I79N probably damaging Het
Jmjd7 T A 2: 120,031,323 Y182* probably null Het
Jup A T 11: 100,383,458 D135E probably benign Het
Kit T A 5: 75,652,808 I881N probably damaging Het
Llgl1 T A 11: 60,702,865 S55T probably benign Het
Lonp2 G A 8: 86,709,096 M653I probably benign Het
Lrp8 T C 4: 107,854,320 Y307H probably damaging Het
Med13 A T 11: 86,278,796 M1914K possibly damaging Het
Ms4a1 A G 19: 11,253,173 probably null Het
Naip1 A G 13: 100,427,341 S439P probably benign Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1129 T A 2: 87,574,918 probably null Het
Olfr835 G T 9: 19,035,301 M59I probably damaging Het
Pds5b T A 5: 150,805,561 probably null Het
Phf12 G A 11: 78,027,373 G804R probably damaging Het
Pou6f2 T C 13: 18,239,489 T234A Het
Prune2 A T 19: 17,120,590 I1153L probably benign Het
Ptprc C T 1: 138,067,885 probably null Het
Qpctl T C 7: 19,149,154 Q11R probably benign Het
Rfx4 A G 10: 84,840,228 K103E possibly damaging Het
Srcin1 T A 11: 97,551,980 probably null Het
St6galnac1 G T 11: 116,768,944 A181D probably damaging Het
Stk36 T C 1: 74,622,239 V475A probably benign Het
Tbc1d21 T C 9: 58,361,288 T263A possibly damaging Het
Tex24 A T 8: 27,345,000 K185N probably damaging Het
Tnxb T A 17: 34,698,153 V2174E possibly damaging Het
Tollip A G 7: 141,890,845 S57P probably benign Het
Zbtb49 A G 5: 38,213,241 probably benign Het
Zfp758 A G 17: 22,361,669 T30A probably benign Het
Other mutations in C1ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:C1ra APN 6 124522291 missense probably benign 0.00
IGL03079:C1ra APN 6 124519835 missense probably damaging 1.00
IGL03151:C1ra APN 6 124519771 missense probably benign 0.09
innate UTSW 6 124522651 missense probably damaging 1.00
mueller-eberhardt UTSW 6 124512801 critical splice donor site probably null
pillemer UTSW 6 124516724 missense probably damaging 1.00
R0331:C1ra UTSW 6 124519435 splice site probably null
R0457:C1ra UTSW 6 124522753 missense probably benign
R0472:C1ra UTSW 6 124517444 missense possibly damaging 0.95
R0570:C1ra UTSW 6 124513705 missense probably benign 0.00
R0634:C1ra UTSW 6 124517505 missense possibly damaging 0.49
R0661:C1ra UTSW 6 124522377 missense probably benign
R1451:C1ra UTSW 6 124521641 missense probably benign 0.04
R1640:C1ra UTSW 6 124522274 missense probably benign 0.17
R1698:C1ra UTSW 6 124522766 missense probably benign 0.05
R4020:C1ra UTSW 6 124519777 missense probably benign 0.01
R4801:C1ra UTSW 6 124513768 missense probably benign 0.00
R4802:C1ra UTSW 6 124513768 missense probably benign 0.00
R4909:C1ra UTSW 6 124522334 missense probably damaging 1.00
R5086:C1ra UTSW 6 124519729 missense probably damaging 1.00
R5108:C1ra UTSW 6 124522922 missense probably damaging 1.00
R5372:C1ra UTSW 6 124521625 missense probably damaging 1.00
R5421:C1ra UTSW 6 124522790 missense probably benign 0.36
R5635:C1ra UTSW 6 124516724 missense probably damaging 1.00
R6438:C1ra UTSW 6 124513777 missense possibly damaging 0.54
R6518:C1ra UTSW 6 124521575 splice site probably null
R6738:C1ra UTSW 6 124517759 missense probably damaging 1.00
R6804:C1ra UTSW 6 124517725 missense probably benign
R6939:C1ra UTSW 6 124512801 critical splice donor site probably null
R6981:C1ra UTSW 6 124517725 missense probably benign
R6982:C1ra UTSW 6 124517725 missense probably benign
R7056:C1ra UTSW 6 124517725 missense probably benign
R7057:C1ra UTSW 6 124517725 missense probably benign
R7094:C1ra UTSW 6 124517725 missense probably benign
R7468:C1ra UTSW 6 124522444 nonsense probably null
R7476:C1ra UTSW 6 124522699 missense probably damaging 1.00
R7478:C1ra UTSW 6 124517725 missense probably benign
R7479:C1ra UTSW 6 124517725 missense probably benign
R7481:C1ra UTSW 6 124517725 missense probably benign
R7512:C1ra UTSW 6 124517725 missense probably benign
R7725:C1ra UTSW 6 124517725 missense probably benign
R7728:C1ra UTSW 6 124517725 missense probably benign
R7730:C1ra UTSW 6 124517725 missense probably benign
R7818:C1ra UTSW 6 124517725 missense probably benign
R7819:C1ra UTSW 6 124517725 missense probably benign
R7835:C1ra UTSW 6 124517725 missense probably benign
R7854:C1ra UTSW 6 124517741 missense probably benign 0.00
R7876:C1ra UTSW 6 124517725 missense probably benign
R7877:C1ra UTSW 6 124517725 missense probably benign
R7881:C1ra UTSW 6 124517725 missense probably benign
R7883:C1ra UTSW 6 124517725 missense probably benign
R7892:C1ra UTSW 6 124519415 missense probably benign 0.07
R7899:C1ra UTSW 6 124517725 missense probably benign
R7901:C1ra UTSW 6 124517725 missense probably benign
R7902:C1ra UTSW 6 124517725 missense probably benign
R7903:C1ra UTSW 6 124517725 missense probably benign
R7947:C1ra UTSW 6 124517379 missense probably benign 0.02
R8087:C1ra UTSW 6 124513872 missense probably damaging 1.00
R8098:C1ra UTSW 6 124517725 missense probably benign
R8099:C1ra UTSW 6 124517725 missense probably benign
R8271:C1ra UTSW 6 124522651 missense probably damaging 1.00
R8300:C1ra UTSW 6 124521638 missense probably benign 0.04
R8824:C1ra UTSW 6 124517695 missense probably damaging 0.99
R9227:C1ra UTSW 6 124516780 missense probably damaging 1.00
R9248:C1ra UTSW 6 124512621 start gained probably benign
R9275:C1ra UTSW 6 124517424 missense probably benign 0.26
R9382:C1ra UTSW 6 124513860 missense probably benign 0.00
R9477:C1ra UTSW 6 124522496 missense probably benign 0.00
X0062:C1ra UTSW 6 124522439 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCTTCCTGGGAAACTTGTG -3'
(R):5'- GAGGGCAGACAGATTGATTCTTC -3'

Sequencing Primer
(F):5'- ACTTGTGTTGAACATGGATGAGACC -3'
(R):5'- GCAGACAGATTGATTCTTCCAGCC -3'
Posted On 2018-09-12