Incidental Mutation 'R6805:Nrg1'
ID 533535
Institutional Source Beutler Lab
Gene Symbol Nrg1
Ensembl Gene ENSMUSG00000062991
Gene Name neuregulin 1
Synonyms NDF, Hgl, GGF, HRG, HGL, SMDF, heregulin, D230005F13Rik, HRGalpha, 6030402G23Rik, ARIA, GGFII
MMRRC Submission 044918-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6805 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 32299493-33381858 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32311292 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 476 (R476G)
Ref Sequence ENSEMBL: ENSMUSP00000146816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073884] [ENSMUST00000207417] [ENSMUST00000207470] [ENSMUST00000208205] [ENSMUST00000208488] [ENSMUST00000208497] [ENSMUST00000208598] [ENSMUST00000208617] [ENSMUST00000208819] [ENSMUST00000209107]
AlphaFold A0A140LHZ9
Predicted Effect probably damaging
Transcript: ENSMUST00000073884
AA Change: R476G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073546
Gene: ENSMUSG00000062991
AA Change: R476G

DomainStartEndE-ValueType
transmembrane domain 78 100 N/A INTRINSIC
low complexity region 180 198 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
EGF 236 277 7.88e-4 SMART
Pfam:Neuregulin 295 688 5.3e-193 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207417
AA Change: R413G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000207470
AA Change: R421G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000208205
AA Change: R416G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000208488
AA Change: R439G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000208497
AA Change: R476G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208598
AA Change: R416G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000208617
AA Change: R416G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000208819
Predicted Effect probably benign
Transcript: ENSMUST00000209107
AA Change: R428G

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit heart defects, impaired development of Schwann cell precursors, cranial ganglia, and radial glia cells, and die at embryonic day 10.5-11.5. Heterozygotes are hyperactive with reduced NMDA receptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 81,946,744 (GRCm39) T214A possibly damaging Het
A930009A15Rik G T 10: 115,415,810 (GRCm39) probably benign Het
Aadac A C 3: 59,944,757 (GRCm39) D143A probably benign Het
Acot10 T G 15: 20,665,452 (GRCm39) T430P probably benign Het
Adgrb3 T C 1: 25,865,253 (GRCm39) T197A possibly damaging Het
Bbs1 A G 19: 4,950,643 (GRCm39) I200T probably damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Cadps G A 14: 12,467,103 (GRCm38) A943V probably damaging Het
Cc2d2a A G 5: 43,838,673 (GRCm39) E48G probably damaging Het
Clca3a1 A T 3: 144,724,428 (GRCm39) C211S probably damaging Het
Col18a1 A G 10: 76,890,073 (GRCm39) L1429P probably damaging Het
Cplane1 T C 15: 8,273,790 (GRCm39) V2591A probably benign Het
Cul2 T G 18: 3,421,263 (GRCm39) Y196D probably damaging Het
D630023F18Rik T C 1: 65,156,365 (GRCm39) S43G probably benign Het
Ddx39a G A 8: 84,449,766 (GRCm39) R427Q probably damaging Het
Def6 A G 17: 28,442,691 (GRCm39) T285A probably damaging Het
Defb21 T A 2: 152,416,789 (GRCm39) D88E probably benign Het
Defb6 A G 8: 19,278,117 (GRCm39) K63R probably benign Het
Dnph1 T C 17: 46,809,670 (GRCm39) S112P probably damaging Het
Dock10 T A 1: 80,564,407 (GRCm39) I467L probably benign Het
Dspp C A 5: 104,323,716 (GRCm39) H286Q probably benign Het
Eya1 T A 1: 14,253,501 (GRCm39) T459S probably benign Het
Faf1 T C 4: 109,719,049 (GRCm39) L385P probably damaging Het
Fbxw21 C A 9: 108,986,633 (GRCm39) R82L probably damaging Het
Fryl A G 5: 73,222,437 (GRCm39) V2048A probably benign Het
Galnt5 A T 2: 57,925,311 (GRCm39) D864V possibly damaging Het
Gata6 T G 18: 11,054,460 (GRCm39) S130A possibly damaging Het
Gbf1 G T 19: 46,250,946 (GRCm39) R434L probably damaging Het
Gga3 A G 11: 115,476,588 (GRCm39) F709L probably damaging Het
Hcar1 A G 5: 124,017,193 (GRCm39) V166A probably benign Het
Hexa T A 9: 59,471,220 (GRCm39) N491K possibly damaging Het
Hpse2 A T 19: 43,282,760 (GRCm39) C164* probably null Het
Ifi202b T C 1: 173,802,555 (GRCm39) Y93C probably damaging Het
Iftap T C 2: 101,396,804 (GRCm39) K192E probably benign Het
Iscu T A 5: 113,913,304 (GRCm39) I79N probably damaging Het
Jmjd7 T A 2: 119,861,804 (GRCm39) Y182* probably null Het
Jup A T 11: 100,274,284 (GRCm39) D135E probably benign Het
Kit T A 5: 75,813,468 (GRCm39) I881N probably damaging Het
Llgl1 T A 11: 60,593,691 (GRCm39) S55T probably benign Het
Lonp2 G A 8: 87,435,724 (GRCm39) M653I probably benign Het
Lrp8 T C 4: 107,711,517 (GRCm39) Y307H probably damaging Het
Med13 A T 11: 86,169,622 (GRCm39) M1914K possibly damaging Het
Ms4a1 A G 19: 11,230,537 (GRCm39) probably null Het
Naip1 A G 13: 100,563,849 (GRCm39) S439P probably benign Het
Or10ag59 T A 2: 87,405,262 (GRCm39) probably null Het
Or7g20 G T 9: 18,946,597 (GRCm39) M59I probably damaging Het
Pds5b T A 5: 150,729,026 (GRCm39) probably null Het
Phf12 G A 11: 77,918,199 (GRCm39) G804R probably damaging Het
Pou6f2 T C 13: 18,414,074 (GRCm39) T234A Het
Prune2 A T 19: 17,097,954 (GRCm39) I1153L probably benign Het
Ptprc C T 1: 137,995,623 (GRCm39) probably null Het
Qpctl T C 7: 18,883,079 (GRCm39) Q11R probably benign Het
Rfx4 A G 10: 84,676,092 (GRCm39) K103E possibly damaging Het
Srcin1 T A 11: 97,442,806 (GRCm39) probably null Het
St6galnac1 G T 11: 116,659,770 (GRCm39) A181D probably damaging Het
Stk36 T C 1: 74,661,398 (GRCm39) V475A probably benign Het
Tbc1d21 T C 9: 58,268,571 (GRCm39) T263A possibly damaging Het
Tex24 A T 8: 27,835,028 (GRCm39) K185N probably damaging Het
Tnxb T A 17: 34,917,127 (GRCm39) V2174E possibly damaging Het
Tollip A G 7: 141,444,582 (GRCm39) S57P probably benign Het
Zbtb49 A G 5: 38,370,585 (GRCm39) probably benign Het
Zfp758 A G 17: 22,580,650 (GRCm39) T30A probably benign Het
Other mutations in Nrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Nrg1 APN 8 32,308,117 (GRCm39) missense probably damaging 0.99
IGL00500:Nrg1 APN 8 32,312,342 (GRCm39) splice site probably null
IGL01150:Nrg1 APN 8 32,407,903 (GRCm39) missense probably damaging 1.00
IGL01998:Nrg1 APN 8 32,408,162 (GRCm39) missense probably damaging 0.99
IGL02010:Nrg1 APN 8 32,408,171 (GRCm39) missense probably benign 0.00
IGL02501:Nrg1 APN 8 32,308,291 (GRCm39) splice site probably null
IGL02741:Nrg1 APN 8 32,312,316 (GRCm39) missense probably damaging 1.00
IGL02754:Nrg1 APN 8 32,316,391 (GRCm39) splice site probably benign
IGL03056:Nrg1 APN 8 32,311,451 (GRCm39) missense possibly damaging 0.93
IGL03121:Nrg1 APN 8 32,314,608 (GRCm39) splice site probably benign
R6805_Nrg1_535 UTSW 8 32,311,292 (GRCm39) missense probably damaging 1.00
R0533:Nrg1 UTSW 8 32,321,273 (GRCm39) splice site probably null
R1170:Nrg1 UTSW 8 32,327,695 (GRCm39) splice site probably benign
R1405:Nrg1 UTSW 8 32,407,855 (GRCm39) missense probably benign 0.16
R1405:Nrg1 UTSW 8 32,407,855 (GRCm39) missense probably benign 0.16
R1486:Nrg1 UTSW 8 32,308,372 (GRCm39) missense probably damaging 1.00
R1642:Nrg1 UTSW 8 32,314,536 (GRCm39) missense probably benign 0.45
R1653:Nrg1 UTSW 8 32,308,681 (GRCm39) missense probably damaging 1.00
R1762:Nrg1 UTSW 8 32,312,351 (GRCm39) missense probably damaging 0.99
R1951:Nrg1 UTSW 8 32,408,221 (GRCm39) missense probably damaging 1.00
R2060:Nrg1 UTSW 8 32,408,043 (GRCm39) missense probably damaging 1.00
R2912:Nrg1 UTSW 8 32,308,595 (GRCm39) missense probably damaging 1.00
R3786:Nrg1 UTSW 8 32,311,411 (GRCm39) missense probably damaging 1.00
R4513:Nrg1 UTSW 8 32,967,105 (GRCm39) intron probably benign
R4569:Nrg1 UTSW 8 32,407,802 (GRCm39) missense probably benign 0.00
R4760:Nrg1 UTSW 8 32,408,228 (GRCm39) nonsense probably null
R4769:Nrg1 UTSW 8 32,408,000 (GRCm39) missense probably damaging 1.00
R4834:Nrg1 UTSW 8 32,407,747 (GRCm39) missense probably benign
R5058:Nrg1 UTSW 8 32,314,587 (GRCm39) missense probably damaging 1.00
R5230:Nrg1 UTSW 8 32,308,507 (GRCm39) missense probably damaging 0.99
R5443:Nrg1 UTSW 8 32,339,348 (GRCm39) missense probably damaging 1.00
R5479:Nrg1 UTSW 8 32,308,405 (GRCm39) missense probably damaging 1.00
R5940:Nrg1 UTSW 8 32,339,372 (GRCm39) missense probably damaging 0.99
R6010:Nrg1 UTSW 8 32,308,600 (GRCm39) missense probably damaging 1.00
R6170:Nrg1 UTSW 8 32,308,508 (GRCm39) missense probably damaging 1.00
R6379:Nrg1 UTSW 8 33,373,749 (GRCm39) start gained probably benign
R6460:Nrg1 UTSW 8 32,308,561 (GRCm39) missense probably damaging 1.00
R6750:Nrg1 UTSW 8 32,308,124 (GRCm39) missense probably damaging 1.00
R6767:Nrg1 UTSW 8 32,407,923 (GRCm39) missense probably damaging 1.00
R6802:Nrg1 UTSW 8 32,311,292 (GRCm39) missense probably damaging 1.00
R6804:Nrg1 UTSW 8 32,311,292 (GRCm39) missense probably damaging 1.00
R6848:Nrg1 UTSW 8 32,308,084 (GRCm39) missense probably damaging 1.00
R6930:Nrg1 UTSW 8 32,308,534 (GRCm39) missense probably damaging 1.00
R6963:Nrg1 UTSW 8 32,407,690 (GRCm39) missense probably benign 0.04
R7070:Nrg1 UTSW 8 32,339,465 (GRCm39) missense probably damaging 0.99
R7176:Nrg1 UTSW 8 32,458,064 (GRCm39) nonsense probably null
R7490:Nrg1 UTSW 8 32,308,682 (GRCm39) missense probably damaging 1.00
R7526:Nrg1 UTSW 8 32,308,351 (GRCm39) missense probably benign 0.00
R7664:Nrg1 UTSW 8 32,499,169 (GRCm39) splice site probably null
R7881:Nrg1 UTSW 8 32,328,352 (GRCm39) nonsense probably null
R8013:Nrg1 UTSW 8 32,439,951 (GRCm39) missense probably benign 0.41
R8342:Nrg1 UTSW 8 32,312,334 (GRCm39) missense probably benign 0.04
R8759:Nrg1 UTSW 8 32,308,103 (GRCm39) missense probably damaging 1.00
R8783:Nrg1 UTSW 8 32,448,629 (GRCm39) missense probably benign 0.09
R9319:Nrg1 UTSW 8 32,323,204 (GRCm39) missense probably benign 0.02
R9429:Nrg1 UTSW 8 32,308,592 (GRCm39) missense probably benign 0.01
R9535:Nrg1 UTSW 8 32,439,995 (GRCm39) missense probably benign 0.13
R9632:Nrg1 UTSW 8 32,407,621 (GRCm39) missense possibly damaging 0.48
Z1088:Nrg1 UTSW 8 32,408,033 (GRCm39) missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AGCTGGCCGATTGGAATTAG -3'
(R):5'- AGCTGGAGTAATGGGCACAC -3'

Sequencing Primer
(F):5'- TACACCTGAAGGCTCCTGC -3'
(R):5'- TGGGCACACAGAAAGCATCATTTC -3'
Posted On 2018-09-12