Incidental Mutation 'R6805:Ddx39'
ID533536
Institutional Source Beutler Lab
Gene Symbol Ddx39
Ensembl Gene ENSMUSG00000005481
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 39
Synonyms2610307C23Rik, BAT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R6805 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location83715177-83726892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 83723137 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 427 (R427Q)
Ref Sequence ENSEMBL: ENSMUSP00000148329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002964] [ENSMUST00000019576] [ENSMUST00000075843] [ENSMUST00000109802] [ENSMUST00000109810] [ENSMUST00000140521] [ENSMUST00000166939] [ENSMUST00000172396] [ENSMUST00000212949]
Predicted Effect probably benign
Transcript: ENSMUST00000002964
SMART Domains Protein: ENSMUSP00000002964
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 167 1.78e-11 SMART
GPS 384 430 2.18e-8 SMART
Pfam:Dicty_CAR 431 703 1.3e-8 PFAM
Pfam:7tm_2 432 672 8.1e-68 PFAM
low complexity region 704 714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000019576
AA Change: R427Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019576
Gene: ENSMUSG00000005481
AA Change: R427Q

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075843
SMART Domains Protein: ENSMUSP00000075240
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 165 213 1.38e-8 SMART
EGF_CA 214 261 1.78e-11 SMART
GPS 478 524 2.18e-8 SMART
Pfam:Dicty_CAR 525 798 4.6e-8 PFAM
Pfam:7tm_2 526 766 5.3e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109802
SMART Domains Protein: ENSMUSP00000105427
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 168 1.38e-8 SMART
EGF_CA 169 216 1.78e-11 SMART
GPS 433 479 2.18e-8 SMART
Pfam:Dicty_CAR 480 752 5.3e-8 PFAM
Pfam:7tm_2 481 721 7.5e-67 PFAM
low complexity region 753 763 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109810
AA Change: R427Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105435
Gene: ENSMUSG00000005481
AA Change: R427Q

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140521
SMART Domains Protein: ENSMUSP00000116101
Gene: ENSMUSG00000005481

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 208 2.82e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166939
SMART Domains Protein: ENSMUSP00000128220
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
EGF 28 66 1.63e1 SMART
EGF_CA 67 117 5.92e-8 SMART
EGF_CA 118 165 1.78e-11 SMART
GPS 382 428 2.18e-8 SMART
Pfam:Dicty_CAR 429 701 2.1e-7 PFAM
Pfam:7tm_2 430 670 1.7e-66 PFAM
low complexity region 702 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172396
AA Change: R427Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132222
Gene: ENSMUSG00000005481
AA Change: R427Q

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212949
AA Change: R427Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. These proteins are characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD) and are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene is thought to play a role in the prognosis of patients with gastrointestinal stromal tumors. A pseudogene of this gene is present on chromosome 13. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,306 V2591A probably benign Het
4930407I10Rik A G 15: 82,062,543 T214A possibly damaging Het
A930009A15Rik G T 10: 115,579,905 probably benign Het
Aadac A C 3: 60,037,336 D143A probably benign Het
Acot10 T G 15: 20,665,366 T430P probably benign Het
Adgrb3 T C 1: 25,826,172 T197A possibly damaging Het
B230118H07Rik T C 2: 101,566,459 K192E probably benign Het
Bbs1 A G 19: 4,900,615 I200T probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cadps G A 14: 12,467,103 A943V probably damaging Het
Cc2d2a A G 5: 43,681,331 E48G probably damaging Het
Clca1 A T 3: 145,018,667 C211S probably damaging Het
Col18a1 A G 10: 77,054,239 L1429P probably damaging Het
Cul2 T G 18: 3,421,263 Y196D probably damaging Het
D630023F18Rik T C 1: 65,117,206 S43G probably benign Het
Def6 A G 17: 28,223,717 T285A probably damaging Het
Defb21 T A 2: 152,574,869 D88E probably benign Het
Defb6 A G 8: 19,228,101 K63R probably benign Het
Dnph1 T C 17: 46,498,744 S112P probably damaging Het
Dock10 T A 1: 80,586,690 I467L probably benign Het
Dspp C A 5: 104,175,850 H286Q probably benign Het
Eya1 T A 1: 14,183,277 T459S probably benign Het
Faf1 T C 4: 109,861,852 L385P probably damaging Het
Fbxw21 C A 9: 109,157,565 R82L probably damaging Het
Fryl A G 5: 73,065,094 V2048A probably benign Het
Galnt5 A T 2: 58,035,299 D864V possibly damaging Het
Gata6 T G 18: 11,054,460 S130A possibly damaging Het
Gbf1 G T 19: 46,262,507 R434L probably damaging Het
Gga3 A G 11: 115,585,762 F709L probably damaging Het
Hcar1 A G 5: 123,879,130 V166A probably benign Het
Hexa T A 9: 59,563,937 N491K possibly damaging Het
Hpse2 A T 19: 43,294,321 C164* probably null Het
Ifi202b T C 1: 173,974,989 Y93C probably damaging Het
Iscu T A 5: 113,775,243 I79N probably damaging Het
Jmjd7 T A 2: 120,031,323 Y182* probably null Het
Jup A T 11: 100,383,458 D135E probably benign Het
Kit T A 5: 75,652,808 I881N probably damaging Het
Llgl1 T A 11: 60,702,865 S55T probably benign Het
Lonp2 G A 8: 86,709,096 M653I probably benign Het
Lrp8 T C 4: 107,854,320 Y307H probably damaging Het
Med13 A T 11: 86,278,796 M1914K possibly damaging Het
Ms4a1 A G 19: 11,253,173 probably null Het
Naip1 A G 13: 100,427,341 S439P probably benign Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1129 T A 2: 87,574,918 probably null Het
Olfr835 G T 9: 19,035,301 M59I probably damaging Het
Pds5b T A 5: 150,805,561 probably null Het
Phf12 G A 11: 78,027,373 G804R probably damaging Het
Pou6f2 T C 13: 18,239,489 T234A Het
Prune2 A T 19: 17,120,590 I1153L probably benign Het
Ptprc C T 1: 138,067,885 probably null Het
Qpctl T C 7: 19,149,154 Q11R probably benign Het
Rfx4 A G 10: 84,840,228 K103E possibly damaging Het
Srcin1 T A 11: 97,551,980 probably null Het
St6galnac1 G T 11: 116,768,944 A181D probably damaging Het
Stk36 T C 1: 74,622,239 V475A probably benign Het
Tbc1d21 T C 9: 58,361,288 T263A possibly damaging Het
Tex24 A T 8: 27,345,000 K185N probably damaging Het
Tnxb T A 17: 34,698,153 V2174E possibly damaging Het
Tollip A G 7: 141,890,845 S57P probably benign Het
Zbtb49 A G 5: 38,213,241 probably benign Het
Zfp758 A G 17: 22,361,669 T30A probably benign Het
Other mutations in Ddx39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02544:Ddx39 APN 8 83722773 missense probably benign 0.03
IGL02712:Ddx39 APN 8 83721757 missense probably benign 0.03
R0038:Ddx39 UTSW 8 83722498 missense probably damaging 1.00
R0038:Ddx39 UTSW 8 83722498 missense probably damaging 1.00
R0051:Ddx39 UTSW 8 83720622 missense possibly damaging 0.83
R0051:Ddx39 UTSW 8 83720622 missense possibly damaging 0.83
R0143:Ddx39 UTSW 8 83720550 missense probably benign 0.22
R0147:Ddx39 UTSW 8 83722476 missense possibly damaging 0.74
R0148:Ddx39 UTSW 8 83722476 missense possibly damaging 0.74
R0392:Ddx39 UTSW 8 83721737 missense probably damaging 0.97
R0426:Ddx39 UTSW 8 83721769 missense probably benign 0.00
R0830:Ddx39 UTSW 8 83719823 missense possibly damaging 0.47
R1509:Ddx39 UTSW 8 83719898 missense probably damaging 1.00
R2935:Ddx39 UTSW 8 83720958 missense possibly damaging 0.57
R3082:Ddx39 UTSW 8 83722706 missense possibly damaging 0.57
R4050:Ddx39 UTSW 8 83722234 missense probably benign 0.00
R4647:Ddx39 UTSW 8 83722273 missense probably benign 0.00
R4804:Ddx39 UTSW 8 83721095 missense probably damaging 0.99
R5242:Ddx39 UTSW 8 83721811 missense probably benign 0.01
R5268:Ddx39 UTSW 8 83722321 missense probably benign 0.08
R6598:Ddx39 UTSW 8 83722927 missense probably benign 0.03
R6852:Ddx39 UTSW 8 83723017 missense probably benign 0.03
R7326:Ddx39 UTSW 8 83722471 missense probably benign 0.31
R7559:Ddx39 UTSW 8 83720966 missense possibly damaging 0.82
R7803:Ddx39 UTSW 8 83719600 critical splice donor site probably null
R8103:Ddx39 UTSW 8 83724476 critical splice acceptor site probably null
X0026:Ddx39 UTSW 8 83722330 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTGGCAGTCACTTTTGTATCG -3'
(R):5'- CCCATGAGATGTTGACCGAAAG -3'

Sequencing Primer
(F):5'- TCGGATGAAAATGATGCCAAAATCC -3'
(R):5'- CGAAAGGGATGGGGCTG -3'
Posted On2018-09-12