Incidental Mutation 'R6805:Olfr835'
ID533537
Institutional Source Beutler Lab
Gene Symbol Olfr835
Ensembl Gene ENSMUSG00000045204
Gene Nameolfactory receptor 835
SynonymsMOR150-3, GA_x6K02T2PVTD-12771995-12772930
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R6805 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location19032735-19037670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19035301 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 59 (M59I)
Ref Sequence ENSEMBL: ENSMUSP00000148416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059315] [ENSMUST00000213018]
Predicted Effect probably damaging
Transcript: ENSMUST00000059315
AA Change: M59I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052610
Gene: ENSMUSG00000045204
AA Change: M59I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 206 2.9e-7 PFAM
Pfam:7tm_1 41 303 1.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213018
AA Change: M59I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,306 V2591A probably benign Het
4930407I10Rik A G 15: 82,062,543 T214A possibly damaging Het
A930009A15Rik G T 10: 115,579,905 probably benign Het
Aadac A C 3: 60,037,336 D143A probably benign Het
Acot10 T G 15: 20,665,366 T430P probably benign Het
Adgrb3 T C 1: 25,826,172 T197A possibly damaging Het
B230118H07Rik T C 2: 101,566,459 K192E probably benign Het
Bbs1 A G 19: 4,900,615 I200T probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cadps G A 14: 12,467,103 A943V probably damaging Het
Cc2d2a A G 5: 43,681,331 E48G probably damaging Het
Clca1 A T 3: 145,018,667 C211S probably damaging Het
Col18a1 A G 10: 77,054,239 L1429P probably damaging Het
Cul2 T G 18: 3,421,263 Y196D probably damaging Het
D630023F18Rik T C 1: 65,117,206 S43G probably benign Het
Ddx39 G A 8: 83,723,137 R427Q probably damaging Het
Def6 A G 17: 28,223,717 T285A probably damaging Het
Defb21 T A 2: 152,574,869 D88E probably benign Het
Defb6 A G 8: 19,228,101 K63R probably benign Het
Dnph1 T C 17: 46,498,744 S112P probably damaging Het
Dock10 T A 1: 80,586,690 I467L probably benign Het
Dspp C A 5: 104,175,850 H286Q probably benign Het
Eya1 T A 1: 14,183,277 T459S probably benign Het
Faf1 T C 4: 109,861,852 L385P probably damaging Het
Fbxw21 C A 9: 109,157,565 R82L probably damaging Het
Fryl A G 5: 73,065,094 V2048A probably benign Het
Galnt5 A T 2: 58,035,299 D864V possibly damaging Het
Gata6 T G 18: 11,054,460 S130A possibly damaging Het
Gbf1 G T 19: 46,262,507 R434L probably damaging Het
Gga3 A G 11: 115,585,762 F709L probably damaging Het
Hcar1 A G 5: 123,879,130 V166A probably benign Het
Hexa T A 9: 59,563,937 N491K possibly damaging Het
Hpse2 A T 19: 43,294,321 C164* probably null Het
Ifi202b T C 1: 173,974,989 Y93C probably damaging Het
Iscu T A 5: 113,775,243 I79N probably damaging Het
Jmjd7 T A 2: 120,031,323 Y182* probably null Het
Jup A T 11: 100,383,458 D135E probably benign Het
Kit T A 5: 75,652,808 I881N probably damaging Het
Llgl1 T A 11: 60,702,865 S55T probably benign Het
Lonp2 G A 8: 86,709,096 M653I probably benign Het
Lrp8 T C 4: 107,854,320 Y307H probably damaging Het
Med13 A T 11: 86,278,796 M1914K possibly damaging Het
Ms4a1 A G 19: 11,253,173 probably null Het
Naip1 A G 13: 100,427,341 S439P probably benign Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1129 T A 2: 87,574,918 probably null Het
Pds5b T A 5: 150,805,561 probably null Het
Phf12 G A 11: 78,027,373 G804R probably damaging Het
Pou6f2 T C 13: 18,239,489 T234A Het
Prune2 A T 19: 17,120,590 I1153L probably benign Het
Ptprc C T 1: 138,067,885 probably null Het
Qpctl T C 7: 19,149,154 Q11R probably benign Het
Rfx4 A G 10: 84,840,228 K103E possibly damaging Het
Srcin1 T A 11: 97,551,980 probably null Het
St6galnac1 G T 11: 116,768,944 A181D probably damaging Het
Stk36 T C 1: 74,622,239 V475A probably benign Het
Tbc1d21 T C 9: 58,361,288 T263A possibly damaging Het
Tex24 A T 8: 27,345,000 K185N probably damaging Het
Tnxb T A 17: 34,698,153 V2174E possibly damaging Het
Tollip A G 7: 141,890,845 S57P probably benign Het
Zbtb49 A G 5: 38,213,241 probably benign Het
Zfp758 A G 17: 22,361,669 T30A probably benign Het
Other mutations in Olfr835
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Olfr835 APN 9 19035288 nonsense probably null
IGL02546:Olfr835 APN 9 19035354 missense possibly damaging 0.88
R0010:Olfr835 UTSW 9 19035322 missense probably damaging 1.00
R0107:Olfr835 UTSW 9 19035333 missense probably damaging 1.00
R1867:Olfr835 UTSW 9 19035266 missense probably benign 0.36
R1891:Olfr835 UTSW 9 19035978 missense probably damaging 0.99
R1941:Olfr835 UTSW 9 19035866 missense possibly damaging 0.93
R4152:Olfr835 UTSW 9 19035520 nonsense probably null
R5451:Olfr835 UTSW 9 19035491 missense probably damaging 1.00
R5677:Olfr835 UTSW 9 19035558 missense possibly damaging 0.93
R5970:Olfr835 UTSW 9 19035147 missense probably benign
R6187:Olfr835 UTSW 9 19035393 missense probably benign 0.12
R7183:Olfr835 UTSW 9 19035332 missense probably damaging 1.00
R8029:Olfr835 UTSW 9 19035794 missense probably damaging 1.00
R8139:Olfr835 UTSW 9 19035575 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GGCCTTTTAGAATATAGGCTACTGTC -3'
(R):5'- GGCCATTGCTGCAAGAAGAC -3'

Sequencing Primer
(F):5'- TTGTCAAAGACATGGGAGGTAAAAAC -3'
(R):5'- TTGCTGCAAGAAGACAGCTTTCG -3'
Posted On2018-09-12