Incidental Mutation 'R6805:Hexa'
ID 533539
Institutional Source Beutler Lab
Gene Symbol Hexa
Ensembl Gene ENSMUSG00000025232
Gene Name hexosaminidase A
Synonyms Hex-1
MMRRC Submission 044918-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.225) question?
Stock # R6805 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 59446966-59472392 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59471220 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 491 (N491K)
Ref Sequence ENSEMBL: ENSMUSP00000026262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026262]
AlphaFold P29416
Predicted Effect possibly damaging
Transcript: ENSMUST00000026262
AA Change: N491K

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026262
Gene: ENSMUSG00000025232
AA Change: N491K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Glycohydro_20b2 23 145 3e-25 PFAM
Pfam:Glyco_hydro_20 167 487 1.6e-88 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: This gene encodes a member of the glycosyl hydrolase 20 family of proteins. The encoded preproprotein is proteolytically processed to generate the alpha subunit of the lysosomal enzyme beta-hexosaminidase. This enzyme, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Mice lacking the encoded protein exhibit accumulation of gangliosides in the brain and membranous cytoplasmic bodies in neurons. Certain mutations in the human ortholog of this gene cause Tay-Sachs disease. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous mutants accumulate excess amounts of GM2 ganglioside that is stored in neurons as membranous cytoplasmic bodies typically seen in the neurons of Tay-Sachs disease patients. However, the mutant mice appear to be functionally normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 81,946,744 (GRCm39) T214A possibly damaging Het
A930009A15Rik G T 10: 115,415,810 (GRCm39) probably benign Het
Aadac A C 3: 59,944,757 (GRCm39) D143A probably benign Het
Acot10 T G 15: 20,665,452 (GRCm39) T430P probably benign Het
Adgrb3 T C 1: 25,865,253 (GRCm39) T197A possibly damaging Het
Bbs1 A G 19: 4,950,643 (GRCm39) I200T probably damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Cadps G A 14: 12,467,103 (GRCm38) A943V probably damaging Het
Cc2d2a A G 5: 43,838,673 (GRCm39) E48G probably damaging Het
Clca3a1 A T 3: 144,724,428 (GRCm39) C211S probably damaging Het
Col18a1 A G 10: 76,890,073 (GRCm39) L1429P probably damaging Het
Cplane1 T C 15: 8,273,790 (GRCm39) V2591A probably benign Het
Cul2 T G 18: 3,421,263 (GRCm39) Y196D probably damaging Het
D630023F18Rik T C 1: 65,156,365 (GRCm39) S43G probably benign Het
Ddx39a G A 8: 84,449,766 (GRCm39) R427Q probably damaging Het
Def6 A G 17: 28,442,691 (GRCm39) T285A probably damaging Het
Defb21 T A 2: 152,416,789 (GRCm39) D88E probably benign Het
Defb6 A G 8: 19,278,117 (GRCm39) K63R probably benign Het
Dnph1 T C 17: 46,809,670 (GRCm39) S112P probably damaging Het
Dock10 T A 1: 80,564,407 (GRCm39) I467L probably benign Het
Dspp C A 5: 104,323,716 (GRCm39) H286Q probably benign Het
Eya1 T A 1: 14,253,501 (GRCm39) T459S probably benign Het
Faf1 T C 4: 109,719,049 (GRCm39) L385P probably damaging Het
Fbxw21 C A 9: 108,986,633 (GRCm39) R82L probably damaging Het
Fryl A G 5: 73,222,437 (GRCm39) V2048A probably benign Het
Galnt5 A T 2: 57,925,311 (GRCm39) D864V possibly damaging Het
Gata6 T G 18: 11,054,460 (GRCm39) S130A possibly damaging Het
Gbf1 G T 19: 46,250,946 (GRCm39) R434L probably damaging Het
Gga3 A G 11: 115,476,588 (GRCm39) F709L probably damaging Het
Hcar1 A G 5: 124,017,193 (GRCm39) V166A probably benign Het
Hpse2 A T 19: 43,282,760 (GRCm39) C164* probably null Het
Ifi202b T C 1: 173,802,555 (GRCm39) Y93C probably damaging Het
Iftap T C 2: 101,396,804 (GRCm39) K192E probably benign Het
Iscu T A 5: 113,913,304 (GRCm39) I79N probably damaging Het
Jmjd7 T A 2: 119,861,804 (GRCm39) Y182* probably null Het
Jup A T 11: 100,274,284 (GRCm39) D135E probably benign Het
Kit T A 5: 75,813,468 (GRCm39) I881N probably damaging Het
Llgl1 T A 11: 60,593,691 (GRCm39) S55T probably benign Het
Lonp2 G A 8: 87,435,724 (GRCm39) M653I probably benign Het
Lrp8 T C 4: 107,711,517 (GRCm39) Y307H probably damaging Het
Med13 A T 11: 86,169,622 (GRCm39) M1914K possibly damaging Het
Ms4a1 A G 19: 11,230,537 (GRCm39) probably null Het
Naip1 A G 13: 100,563,849 (GRCm39) S439P probably benign Het
Nrg1 T C 8: 32,311,292 (GRCm39) R476G probably damaging Het
Or10ag59 T A 2: 87,405,262 (GRCm39) probably null Het
Or7g20 G T 9: 18,946,597 (GRCm39) M59I probably damaging Het
Pds5b T A 5: 150,729,026 (GRCm39) probably null Het
Phf12 G A 11: 77,918,199 (GRCm39) G804R probably damaging Het
Pou6f2 T C 13: 18,414,074 (GRCm39) T234A Het
Prune2 A T 19: 17,097,954 (GRCm39) I1153L probably benign Het
Ptprc C T 1: 137,995,623 (GRCm39) probably null Het
Qpctl T C 7: 18,883,079 (GRCm39) Q11R probably benign Het
Rfx4 A G 10: 84,676,092 (GRCm39) K103E possibly damaging Het
Srcin1 T A 11: 97,442,806 (GRCm39) probably null Het
St6galnac1 G T 11: 116,659,770 (GRCm39) A181D probably damaging Het
Stk36 T C 1: 74,661,398 (GRCm39) V475A probably benign Het
Tbc1d21 T C 9: 58,268,571 (GRCm39) T263A possibly damaging Het
Tex24 A T 8: 27,835,028 (GRCm39) K185N probably damaging Het
Tnxb T A 17: 34,917,127 (GRCm39) V2174E possibly damaging Het
Tollip A G 7: 141,444,582 (GRCm39) S57P probably benign Het
Zbtb49 A G 5: 38,370,585 (GRCm39) probably benign Het
Zfp758 A G 17: 22,580,650 (GRCm39) T30A probably benign Het
Other mutations in Hexa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01877:Hexa APN 9 59,471,163 (GRCm39) splice site probably benign
IGL02078:Hexa APN 9 59,464,586 (GRCm39) missense probably benign 0.36
R0098:Hexa UTSW 9 59,465,383 (GRCm39) missense probably damaging 1.00
R0098:Hexa UTSW 9 59,465,383 (GRCm39) missense probably damaging 1.00
R0281:Hexa UTSW 9 59,461,509 (GRCm39) critical splice donor site probably null
R0364:Hexa UTSW 9 59,471,218 (GRCm39) missense probably benign 0.00
R0481:Hexa UTSW 9 59,462,693 (GRCm39) splice site probably benign
R1888:Hexa UTSW 9 59,464,586 (GRCm39) missense probably benign 0.36
R1888:Hexa UTSW 9 59,464,586 (GRCm39) missense probably benign 0.36
R2264:Hexa UTSW 9 59,462,660 (GRCm39) missense probably damaging 0.99
R3545:Hexa UTSW 9 59,464,581 (GRCm39) missense probably damaging 0.99
R4609:Hexa UTSW 9 59,464,602 (GRCm39) missense probably benign 0.32
R5777:Hexa UTSW 9 59,468,243 (GRCm39) missense probably damaging 0.99
R6041:Hexa UTSW 9 59,470,519 (GRCm39) missense probably damaging 0.99
R6403:Hexa UTSW 9 59,464,644 (GRCm39) missense probably damaging 1.00
R6776:Hexa UTSW 9 59,465,355 (GRCm39) missense probably damaging 1.00
R6912:Hexa UTSW 9 59,447,221 (GRCm39) missense probably damaging 1.00
R7285:Hexa UTSW 9 59,471,222 (GRCm39) missense probably benign 0.02
R7467:Hexa UTSW 9 59,464,683 (GRCm39) critical splice donor site probably null
R7556:Hexa UTSW 9 59,470,582 (GRCm39) missense probably damaging 1.00
R7574:Hexa UTSW 9 59,471,267 (GRCm39) missense probably benign 0.22
R7614:Hexa UTSW 9 59,469,230 (GRCm39) missense probably damaging 1.00
R8550:Hexa UTSW 9 59,468,182 (GRCm39) missense probably benign 0.01
R9418:Hexa UTSW 9 59,464,592 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TAATGAGGGTGCAACTGAGCC -3'
(R):5'- GGGGCTGTATACTCCTAAAATGG -3'

Sequencing Primer
(F):5'- AGCCCTGGAACTGCCTTAGAG -3'
(R):5'- TGGAGACAAAATGTTCCCACCTATG -3'
Posted On 2018-09-12