Incidental Mutation 'R6805:Hexa'
ID 533539
Institutional Source Beutler Lab
Gene Symbol Hexa
Ensembl Gene ENSMUSG00000025232
Gene Name hexosaminidase A
Synonyms Hex-1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.232) question?
Stock # R6805 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 59539540-59565109 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59563937 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 491 (N491K)
Ref Sequence ENSEMBL: ENSMUSP00000026262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026262]
AlphaFold P29416
Predicted Effect possibly damaging
Transcript: ENSMUST00000026262
AA Change: N491K

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026262
Gene: ENSMUSG00000025232
AA Change: N491K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Glycohydro_20b2 23 145 3e-25 PFAM
Pfam:Glyco_hydro_20 167 487 1.6e-88 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: This gene encodes a member of the glycosyl hydrolase 20 family of proteins. The encoded preproprotein is proteolytically processed to generate the alpha subunit of the lysosomal enzyme beta-hexosaminidase. This enzyme, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Mice lacking the encoded protein exhibit accumulation of gangliosides in the brain and membranous cytoplasmic bodies in neurons. Certain mutations in the human ortholog of this gene cause Tay-Sachs disease. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous mutants accumulate excess amounts of GM2 ganglioside that is stored in neurons as membranous cytoplasmic bodies typically seen in the neurons of Tay-Sachs disease patients. However, the mutant mice appear to be functionally normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,306 V2591A probably benign Het
4930407I10Rik A G 15: 82,062,543 T214A possibly damaging Het
A930009A15Rik G T 10: 115,579,905 probably benign Het
Aadac A C 3: 60,037,336 D143A probably benign Het
Acot10 T G 15: 20,665,366 T430P probably benign Het
Adgrb3 T C 1: 25,826,172 T197A possibly damaging Het
B230118H07Rik T C 2: 101,566,459 K192E probably benign Het
Bbs1 A G 19: 4,900,615 I200T probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cadps G A 14: 12,467,103 A943V probably damaging Het
Cc2d2a A G 5: 43,681,331 E48G probably damaging Het
Clca1 A T 3: 145,018,667 C211S probably damaging Het
Col18a1 A G 10: 77,054,239 L1429P probably damaging Het
Cul2 T G 18: 3,421,263 Y196D probably damaging Het
D630023F18Rik T C 1: 65,117,206 S43G probably benign Het
Ddx39 G A 8: 83,723,137 R427Q probably damaging Het
Def6 A G 17: 28,223,717 T285A probably damaging Het
Defb21 T A 2: 152,574,869 D88E probably benign Het
Defb6 A G 8: 19,228,101 K63R probably benign Het
Dnph1 T C 17: 46,498,744 S112P probably damaging Het
Dock10 T A 1: 80,586,690 I467L probably benign Het
Dspp C A 5: 104,175,850 H286Q probably benign Het
Eya1 T A 1: 14,183,277 T459S probably benign Het
Faf1 T C 4: 109,861,852 L385P probably damaging Het
Fbxw21 C A 9: 109,157,565 R82L probably damaging Het
Fryl A G 5: 73,065,094 V2048A probably benign Het
Galnt5 A T 2: 58,035,299 D864V possibly damaging Het
Gata6 T G 18: 11,054,460 S130A possibly damaging Het
Gbf1 G T 19: 46,262,507 R434L probably damaging Het
Gga3 A G 11: 115,585,762 F709L probably damaging Het
Hcar1 A G 5: 123,879,130 V166A probably benign Het
Hpse2 A T 19: 43,294,321 C164* probably null Het
Ifi202b T C 1: 173,974,989 Y93C probably damaging Het
Iscu T A 5: 113,775,243 I79N probably damaging Het
Jmjd7 T A 2: 120,031,323 Y182* probably null Het
Jup A T 11: 100,383,458 D135E probably benign Het
Kit T A 5: 75,652,808 I881N probably damaging Het
Llgl1 T A 11: 60,702,865 S55T probably benign Het
Lonp2 G A 8: 86,709,096 M653I probably benign Het
Lrp8 T C 4: 107,854,320 Y307H probably damaging Het
Med13 A T 11: 86,278,796 M1914K possibly damaging Het
Ms4a1 A G 19: 11,253,173 probably null Het
Naip1 A G 13: 100,427,341 S439P probably benign Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1129 T A 2: 87,574,918 probably null Het
Olfr835 G T 9: 19,035,301 M59I probably damaging Het
Pds5b T A 5: 150,805,561 probably null Het
Phf12 G A 11: 78,027,373 G804R probably damaging Het
Pou6f2 T C 13: 18,239,489 T234A Het
Prune2 A T 19: 17,120,590 I1153L probably benign Het
Ptprc C T 1: 138,067,885 probably null Het
Qpctl T C 7: 19,149,154 Q11R probably benign Het
Rfx4 A G 10: 84,840,228 K103E possibly damaging Het
Srcin1 T A 11: 97,551,980 probably null Het
St6galnac1 G T 11: 116,768,944 A181D probably damaging Het
Stk36 T C 1: 74,622,239 V475A probably benign Het
Tbc1d21 T C 9: 58,361,288 T263A possibly damaging Het
Tex24 A T 8: 27,345,000 K185N probably damaging Het
Tnxb T A 17: 34,698,153 V2174E possibly damaging Het
Tollip A G 7: 141,890,845 S57P probably benign Het
Zbtb49 A G 5: 38,213,241 probably benign Het
Zfp758 A G 17: 22,361,669 T30A probably benign Het
Other mutations in Hexa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01877:Hexa APN 9 59563880 splice site probably benign
IGL02078:Hexa APN 9 59557303 missense probably benign 0.36
R0098:Hexa UTSW 9 59558100 missense probably damaging 1.00
R0098:Hexa UTSW 9 59558100 missense probably damaging 1.00
R0281:Hexa UTSW 9 59554226 critical splice donor site probably null
R0364:Hexa UTSW 9 59563935 missense probably benign 0.00
R0481:Hexa UTSW 9 59555410 splice site probably benign
R1888:Hexa UTSW 9 59557303 missense probably benign 0.36
R1888:Hexa UTSW 9 59557303 missense probably benign 0.36
R2264:Hexa UTSW 9 59555377 missense probably damaging 0.99
R3545:Hexa UTSW 9 59557298 missense probably damaging 0.99
R4609:Hexa UTSW 9 59557319 missense probably benign 0.32
R5777:Hexa UTSW 9 59560960 missense probably damaging 0.99
R6041:Hexa UTSW 9 59563236 missense probably damaging 0.99
R6403:Hexa UTSW 9 59557361 missense probably damaging 1.00
R6776:Hexa UTSW 9 59558072 missense probably damaging 1.00
R6912:Hexa UTSW 9 59539938 missense probably damaging 1.00
R7285:Hexa UTSW 9 59563939 missense probably benign 0.02
R7467:Hexa UTSW 9 59557400 critical splice donor site probably null
R7556:Hexa UTSW 9 59563299 missense probably damaging 1.00
R7574:Hexa UTSW 9 59563984 missense probably benign 0.22
R7614:Hexa UTSW 9 59561947 missense probably damaging 1.00
R8550:Hexa UTSW 9 59560899 missense probably benign 0.01
R9418:Hexa UTSW 9 59557309 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TAATGAGGGTGCAACTGAGCC -3'
(R):5'- GGGGCTGTATACTCCTAAAATGG -3'

Sequencing Primer
(F):5'- AGCCCTGGAACTGCCTTAGAG -3'
(R):5'- TGGAGACAAAATGTTCCCACCTATG -3'
Posted On 2018-09-12