Mutagenetix > Incidental Mutation

Incidental Mutation 'R6805:Rfx4'

533542

Institutional Source

Beutler Lab

Gene Symbol

Rfx4

Ensembl Gene

ENSMUSG00000020037

Gene Name

regulatory factor X, 4 (influences HLA class II expression)

Synonyms

4933412G19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6805 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84756062-84906538 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 84840228 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 103 (K103E)

Ref Sequence

ENSEMBL: ENSMUSP00000093035 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060397] [ENSMUST00000095388] [ENSMUST00000166696]

AlphaFold

Q7TNK1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000060397
AA Change: K197E

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000051107
Gene: ENSMUSG00000020037
AA Change: K197E

Domain	Start	End	E-Value	Type
Pfam:RFX_DNA_binding	58	136	7.9e-37	PFAM
Blast:HisKA	293	356	5e-7	BLAST
low complexity region	503	515	N/A	INTRINSIC
low complexity region	521	537	N/A	INTRINSIC
low complexity region	599	611	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095388
AA Change: K103E

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000093035
Gene: ENSMUSG00000020037
AA Change: K103E

Domain	Start	End	E-Value	Type
SCOP:d1kwha_	11	201	6e-3	SMART
Blast:HisKA	199	262	4e-7	BLAST
low complexity region	409	421	N/A	INTRINSIC
low complexity region	427	443	N/A	INTRINSIC
low complexity region	505	517	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166696
AA Change: K54E

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000128690
Gene: ENSMUSG00000020037
AA Change: K54E

Domain	Start	End	E-Value	Type
Blast:HisKA	150	213	6e-7	BLAST
low complexity region	360	372	N/A	INTRINSIC
low complexity region	378	394	N/A	INTRINSIC
low complexity region	456	468	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.8%
20x: 97.1%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X3, and X5. It has been shown to interact with itself as well as with regulatory factors X2 and X3, but it does not interact with regulatory factor X1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Inactivating null allele or homozygous point mutation alleles exhibit missing dorsal midline structure of the cortex including the subcommissural organ and neonatal lethality. Heterozygous null mice have congenital hydrocephalus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,244,306	V2591A	probably benign	Het
4930407I10Rik	A	G	15: 82,062,543	T214A	possibly damaging	Het
A930009A15Rik	G	T	10: 115,579,905		probably benign	Het
Aadac	A	C	3: 60,037,336	D143A	probably benign	Het
Acot10	T	G	15: 20,665,366	T430P	probably benign	Het
Adgrb3	T	C	1: 25,826,172	T197A	possibly damaging	Het
B230118H07Rik	T	C	2: 101,566,459	K192E	probably benign	Het
Bbs1	A	G	19: 4,900,615	I200T	probably damaging	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
Cadps	G	A	14: 12,467,103	A943V	probably damaging	Het
Cc2d2a	A	G	5: 43,681,331	E48G	probably damaging	Het
Clca1	A	T	3: 145,018,667	C211S	probably damaging	Het
Col18a1	A	G	10: 77,054,239	L1429P	probably damaging	Het
Cul2	T	G	18: 3,421,263	Y196D	probably damaging	Het
D630023F18Rik	T	C	1: 65,117,206	S43G	probably benign	Het
Ddx39	G	A	8: 83,723,137	R427Q	probably damaging	Het
Def6	A	G	17: 28,223,717	T285A	probably damaging	Het
Defb21	T	A	2: 152,574,869	D88E	probably benign	Het
Defb6	A	G	8: 19,228,101	K63R	probably benign	Het
Dnph1	T	C	17: 46,498,744	S112P	probably damaging	Het
Dock10	T	A	1: 80,586,690	I467L	probably benign	Het
Dspp	C	A	5: 104,175,850	H286Q	probably benign	Het
Eya1	T	A	1: 14,183,277	T459S	probably benign	Het
Faf1	T	C	4: 109,861,852	L385P	probably damaging	Het
Fbxw21	C	A	9: 109,157,565	R82L	probably damaging	Het
Fryl	A	G	5: 73,065,094	V2048A	probably benign	Het
Galnt5	A	T	2: 58,035,299	D864V	possibly damaging	Het
Gata6	T	G	18: 11,054,460	S130A	possibly damaging	Het
Gbf1	G	T	19: 46,262,507	R434L	probably damaging	Het
Gga3	A	G	11: 115,585,762	F709L	probably damaging	Het
Hcar1	A	G	5: 123,879,130	V166A	probably benign	Het
Hexa	T	A	9: 59,563,937	N491K	possibly damaging	Het
Hpse2	A	T	19: 43,294,321	C164*	probably null	Het
Ifi202b	T	C	1: 173,974,989	Y93C	probably damaging	Het
Iscu	T	A	5: 113,775,243	I79N	probably damaging	Het
Jmjd7	T	A	2: 120,031,323	Y182*	probably null	Het
Jup	A	T	11: 100,383,458	D135E	probably benign	Het
Kit	T	A	5: 75,652,808	I881N	probably damaging	Het
Llgl1	T	A	11: 60,702,865	S55T	probably benign	Het
Lonp2	G	A	8: 86,709,096	M653I	probably benign	Het
Lrp8	T	C	4: 107,854,320	Y307H	probably damaging	Het
Med13	A	T	11: 86,278,796	M1914K	possibly damaging	Het
Ms4a1	A	G	19: 11,253,173		probably null	Het
Naip1	A	G	13: 100,427,341	S439P	probably benign	Het
Nrg1	T	C	8: 31,821,264	R476G	probably damaging	Het
Olfr1129	T	A	2: 87,574,918		probably null	Het
Olfr835	G	T	9: 19,035,301	M59I	probably damaging	Het
Pds5b	T	A	5: 150,805,561		probably null	Het
Phf12	G	A	11: 78,027,373	G804R	probably damaging	Het
Pou6f2	T	C	13: 18,239,489	T234A		Het
Prune2	A	T	19: 17,120,590	I1153L	probably benign	Het
Ptprc	C	T	1: 138,067,885		probably null	Het
Qpctl	T	C	7: 19,149,154	Q11R	probably benign	Het
Srcin1	T	A	11: 97,551,980		probably null	Het
St6galnac1	G	T	11: 116,768,944	A181D	probably damaging	Het
Stk36	T	C	1: 74,622,239	V475A	probably benign	Het
Tbc1d21	T	C	9: 58,361,288	T263A	possibly damaging	Het
Tex24	A	T	8: 27,345,000	K185N	probably damaging	Het
Tnxb	T	A	17: 34,698,153	V2174E	possibly damaging	Het
Tollip	A	G	7: 141,890,845	S57P	probably benign	Het
Zbtb49	A	G	5: 38,213,241		probably benign	Het
Zfp758	A	G	17: 22,361,669	T30A	probably benign	Het

Other mutations in Rfx4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Rfx4	APN	10	84840199	missense	probably damaging	1.00
IGL00334:Rfx4	APN	10	84780053	missense	possibly damaging	0.91
IGL00928:Rfx4	APN	10	84840114	missense	probably benign	0.04
IGL01063:Rfx4	APN	10	84868382	missense	possibly damaging	0.90
IGL01490:Rfx4	APN	10	84840851	missense	possibly damaging	0.85
IGL02390:Rfx4	APN	10	84840150	missense	probably damaging	1.00
IGL02454:Rfx4	APN	10	84840106	missense	possibly damaging	0.83
R0099:Rfx4	UTSW	10	84894304	missense	probably benign
R0503:Rfx4	UTSW	10	84894332	missense	possibly damaging	0.56
R0924:Rfx4	UTSW	10	84868427	missense	probably damaging	1.00
R0930:Rfx4	UTSW	10	84868427	missense	probably damaging	1.00
R1386:Rfx4	UTSW	10	84863285	missense	probably damaging	1.00
R1715:Rfx4	UTSW	10	84844280	missense	probably damaging	1.00
R1738:Rfx4	UTSW	10	84880975	critical splice donor site	probably null
R1987:Rfx4	UTSW	10	84896088	missense	possibly damaging	0.87
R3717:Rfx4	UTSW	10	84880224	missense	probably damaging	1.00
R4231:Rfx4	UTSW	10	84814694	missense	probably benign	0.03
R4300:Rfx4	UTSW	10	84905102	missense	probably damaging	0.98
R4581:Rfx4	UTSW	10	84844300	missense	possibly damaging	0.93
R4582:Rfx4	UTSW	10	84844300	missense	possibly damaging	0.93
R4618:Rfx4	UTSW	10	84880896	missense	probably benign	0.01
R5156:Rfx4	UTSW	10	84868354	missense	probably damaging	1.00
R5185:Rfx4	UTSW	10	84863250	missense	probably damaging	1.00
R5377:Rfx4	UTSW	10	84860542	missense	possibly damaging	0.81
R5601:Rfx4	UTSW	10	84798578	missense	probably damaging	1.00
R5879:Rfx4	UTSW	10	84814761	critical splice donor site	probably null
R5996:Rfx4	UTSW	10	84840017	nonsense	probably null
R6358:Rfx4	UTSW	10	84844235	missense	probably damaging	1.00
R7248:Rfx4	UTSW	10	84905055	missense	probably benign	0.05
R7427:Rfx4	UTSW	10	84896012	missense	probably benign	0.28
R7428:Rfx4	UTSW	10	84896012	missense	probably benign	0.28
R7514:Rfx4	UTSW	10	84880226	missense	probably damaging	1.00
R7576:Rfx4	UTSW	10	84863349	missense	probably damaging	0.98
R8002:Rfx4	UTSW	10	84840857	missense	probably damaging	0.97
R8838:Rfx4	UTSW	10	84840894	missense	probably damaging	1.00
R8938:Rfx4	UTSW	10	84840072	missense	probably damaging	1.00
R9359:Rfx4	UTSW	10	84905057	missense	probably benign	0.00
R9513:Rfx4	UTSW	10	84838186	start codon destroyed	probably null	0.01
RF010:Rfx4	UTSW	10	84858487	critical splice acceptor site	probably benign
RF014:Rfx4	UTSW	10	84858489	critical splice acceptor site	probably benign
RF015:Rfx4	UTSW	10	84858489	critical splice acceptor site	probably benign
RF023:Rfx4	UTSW	10	84858485	critical splice acceptor site	probably benign
RF030:Rfx4	UTSW	10	84858480	critical splice acceptor site	probably benign
RF035:Rfx4	UTSW	10	84858480	critical splice acceptor site	probably benign
RF046:Rfx4	UTSW	10	84858481	critical splice acceptor site	probably benign
RF060:Rfx4	UTSW	10	84858494	critical splice acceptor site	probably benign
RF062:Rfx4	UTSW	10	84858481	critical splice acceptor site	probably benign
X0024:Rfx4	UTSW	10	84780074	missense	possibly damaging	0.82
Z1177:Rfx4	UTSW	10	84814684	missense	possibly damaging	0.85
Z1177:Rfx4	UTSW	10	84896091	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- GAGCTCCCAGTATTATGATGTGATG -3'
(R):5'- GGCGAGGGCACTAAATTCTC -3'

Sequencing Primer
(F):5'- TGTACTCAAAGAAAGGAGCTGCC -3'
(R):5'- GGCACTAAATTCTCCTTGTGGCTAAG -3'

Posted On

2018-09-12