Mutagenetix > Incidental Mutation

Incidental Mutation 'R6805:Med13'

533546

Institutional Source

Beutler Lab

Gene Symbol

Med13

Ensembl Gene

ENSMUSG00000034297

Gene Name

mediator complex subunit 13

Synonyms

Thrap1, 1110067M05Rik, Trap240

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.949) question?

Stock #

R6805 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86267033-86357602 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 86278796 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1914 (M1914K)

Ref Sequence

ENSEMBL: ENSMUSP00000044268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043624]

AlphaFold

Q5SWW4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043624
AA Change: M1914K

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297
AA Change: M1914K

Domain	Start	End	E-Value	Type
Pfam:Med13_N	1	384	5e-130	PFAM
low complexity region	438	451	N/A	INTRINSIC
low complexity region	531	540	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	984	998	N/A	INTRINSIC
low complexity region	1001	1029	N/A	INTRINSIC
low complexity region	1463	1476	N/A	INTRINSIC
low complexity region	1502	1517	N/A	INTRINSIC
low complexity region	1522	1550	N/A	INTRINSIC
low complexity region	1559	1570	N/A	INTRINSIC
low complexity region	1577	1596	N/A	INTRINSIC
Pfam:Med13_C	1637	2161	3.5e-146	PFAM

Meta Mutation Damage Score

0.5367

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.8%
20x: 97.1%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,244,306	V2591A	probably benign	Het
4930407I10Rik	A	G	15: 82,062,543	T214A	possibly damaging	Het
A930009A15Rik	G	T	10: 115,579,905		probably benign	Het
Aadac	A	C	3: 60,037,336	D143A	probably benign	Het
Acot10	T	G	15: 20,665,366	T430P	probably benign	Het
Adgrb3	T	C	1: 25,826,172	T197A	possibly damaging	Het
B230118H07Rik	T	C	2: 101,566,459	K192E	probably benign	Het
Bbs1	A	G	19: 4,900,615	I200T	probably damaging	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
Cadps	G	A	14: 12,467,103	A943V	probably damaging	Het
Cc2d2a	A	G	5: 43,681,331	E48G	probably damaging	Het
Clca1	A	T	3: 145,018,667	C211S	probably damaging	Het
Col18a1	A	G	10: 77,054,239	L1429P	probably damaging	Het
Cul2	T	G	18: 3,421,263	Y196D	probably damaging	Het
D630023F18Rik	T	C	1: 65,117,206	S43G	probably benign	Het
Ddx39	G	A	8: 83,723,137	R427Q	probably damaging	Het
Def6	A	G	17: 28,223,717	T285A	probably damaging	Het
Defb21	T	A	2: 152,574,869	D88E	probably benign	Het
Defb6	A	G	8: 19,228,101	K63R	probably benign	Het
Dnph1	T	C	17: 46,498,744	S112P	probably damaging	Het
Dock10	T	A	1: 80,586,690	I467L	probably benign	Het
Dspp	C	A	5: 104,175,850	H286Q	probably benign	Het
Eya1	T	A	1: 14,183,277	T459S	probably benign	Het
Faf1	T	C	4: 109,861,852	L385P	probably damaging	Het
Fbxw21	C	A	9: 109,157,565	R82L	probably damaging	Het
Fryl	A	G	5: 73,065,094	V2048A	probably benign	Het
Galnt5	A	T	2: 58,035,299	D864V	possibly damaging	Het
Gata6	T	G	18: 11,054,460	S130A	possibly damaging	Het
Gbf1	G	T	19: 46,262,507	R434L	probably damaging	Het
Gga3	A	G	11: 115,585,762	F709L	probably damaging	Het
Hcar1	A	G	5: 123,879,130	V166A	probably benign	Het
Hexa	T	A	9: 59,563,937	N491K	possibly damaging	Het
Hpse2	A	T	19: 43,294,321	C164*	probably null	Het
Ifi202b	T	C	1: 173,974,989	Y93C	probably damaging	Het
Iscu	T	A	5: 113,775,243	I79N	probably damaging	Het
Jmjd7	T	A	2: 120,031,323	Y182*	probably null	Het
Jup	A	T	11: 100,383,458	D135E	probably benign	Het
Kit	T	A	5: 75,652,808	I881N	probably damaging	Het
Llgl1	T	A	11: 60,702,865	S55T	probably benign	Het
Lonp2	G	A	8: 86,709,096	M653I	probably benign	Het
Lrp8	T	C	4: 107,854,320	Y307H	probably damaging	Het
Ms4a1	A	G	19: 11,253,173		probably null	Het
Naip1	A	G	13: 100,427,341	S439P	probably benign	Het
Nrg1	T	C	8: 31,821,264	R476G	probably damaging	Het
Olfr1129	T	A	2: 87,574,918		probably null	Het
Olfr835	G	T	9: 19,035,301	M59I	probably damaging	Het
Pds5b	T	A	5: 150,805,561		probably null	Het
Phf12	G	A	11: 78,027,373	G804R	probably damaging	Het
Pou6f2	T	C	13: 18,239,489	T234A		Het
Prune2	A	T	19: 17,120,590	I1153L	probably benign	Het
Ptprc	C	T	1: 138,067,885		probably null	Het
Qpctl	T	C	7: 19,149,154	Q11R	probably benign	Het
Rfx4	A	G	10: 84,840,228	K103E	possibly damaging	Het
Srcin1	T	A	11: 97,551,980		probably null	Het
St6galnac1	G	T	11: 116,768,944	A181D	probably damaging	Het
Stk36	T	C	1: 74,622,239	V475A	probably benign	Het
Tbc1d21	T	C	9: 58,361,288	T263A	possibly damaging	Het
Tex24	A	T	8: 27,345,000	K185N	probably damaging	Het
Tnxb	T	A	17: 34,698,153	V2174E	possibly damaging	Het
Tollip	A	G	7: 141,890,845	S57P	probably benign	Het
Zbtb49	A	G	5: 38,213,241		probably benign	Het
Zfp758	A	G	17: 22,361,669	T30A	probably benign	Het

Other mutations in Med13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00960:Med13	APN	11	86291040	splice site	probably benign
IGL01391:Med13	APN	11	86328497	missense	probably benign
IGL01767:Med13	APN	11	86319783	missense	probably benign	0.38
IGL01830:Med13	APN	11	86288928	splice site	probably benign
IGL01859:Med13	APN	11	86283751	missense	possibly damaging	0.86
IGL01924:Med13	APN	11	86308696	splice site	probably benign
IGL02080:Med13	APN	11	86283812	missense	probably damaging	0.97
IGL02138:Med13	APN	11	86286765	missense	probably damaging	0.99
IGL02259:Med13	APN	11	86357501	missense	possibly damaging	0.89
IGL02339:Med13	APN	11	86288939	missense	probably benign	0.16
IGL02399:Med13	APN	11	86283945	splice site	probably benign
IGL02646:Med13	APN	11	86283386	missense	probably benign	0.00
IGL03227:Med13	APN	11	86327792	splice site	probably benign
R0197_Med13_854	UTSW	11	86307038	missense	probably benign	0.13
R0360_Med13_060	UTSW	11	86329161	splice site	probably benign
R2359_Med13_079	UTSW	11	86291035	splice site	probably benign
R3735_Med13_085	UTSW	11	86279658	missense	probably benign	0.00
R4974_Med13_508	UTSW	11	86298847	missense	probably damaging	0.98
R0116:Med13	UTSW	11	86319897	missense	probably damaging	0.99
R0189:Med13	UTSW	11	86319876	missense	probably benign
R0197:Med13	UTSW	11	86307038	missense	probably benign	0.13
R0206:Med13	UTSW	11	86300856	splice site	probably benign
R0208:Med13	UTSW	11	86300856	splice site	probably benign
R0310:Med13	UTSW	11	86346003	missense	probably benign	0.11
R0360:Med13	UTSW	11	86329161	splice site	probably benign
R0413:Med13	UTSW	11	86299207	splice site	probably benign
R0482:Med13	UTSW	11	86285151	missense	probably benign	0.41
R0497:Med13	UTSW	11	86276983	splice site	probably benign
R0589:Med13	UTSW	11	86283249	missense	probably damaging	1.00
R0601:Med13	UTSW	11	86345962	missense	possibly damaging	0.47
R0646:Med13	UTSW	11	86331089	missense	possibly damaging	0.95
R0701:Med13	UTSW	11	86307038	missense	probably benign	0.13
R0709:Med13	UTSW	11	86319596	missense	possibly damaging	0.95
R0711:Med13	UTSW	11	86301353	splice site	probably benign
R0734:Med13	UTSW	11	86301237	missense	probably benign
R0883:Med13	UTSW	11	86307038	missense	probably benign	0.13
R1793:Med13	UTSW	11	86329351	missense	probably benign	0.45
R1926:Med13	UTSW	11	86289073	missense	possibly damaging	0.47
R1959:Med13	UTSW	11	86298979	missense	probably damaging	1.00
R2286:Med13	UTSW	11	86319689	missense	probably benign	0.05
R2359:Med13	UTSW	11	86291035	splice site	probably benign
R2444:Med13	UTSW	11	86331960	missense	probably damaging	1.00
R2679:Med13	UTSW	11	86298577	missense	probably benign	0.00
R2879:Med13	UTSW	11	86299162	missense	possibly damaging	0.61
R3439:Med13	UTSW	11	86285297	missense	probably damaging	1.00
R3735:Med13	UTSW	11	86279658	missense	probably benign	0.00
R4333:Med13	UTSW	11	86288183	missense	probably benign
R4558:Med13	UTSW	11	86299054	missense	probably damaging	1.00
R4598:Med13	UTSW	11	86278566	missense	probably damaging	0.97
R4773:Med13	UTSW	11	86276920	missense	probably damaging	0.99
R4801:Med13	UTSW	11	86278773	missense	probably damaging	1.00
R4802:Med13	UTSW	11	86278773	missense	probably damaging	1.00
R4806:Med13	UTSW	11	86298577	missense	probably benign	0.00
R4940:Med13	UTSW	11	86288118	missense	probably damaging	1.00
R4974:Med13	UTSW	11	86298847	missense	probably damaging	0.98
R5056:Med13	UTSW	11	86328565	missense	probably benign	0.00
R5133:Med13	UTSW	11	86319849	missense	probably benign	0.32
R5206:Med13	UTSW	11	86319879	missense	probably damaging	1.00
R5352:Med13	UTSW	11	86301468	missense	possibly damaging	0.82
R5534:Med13	UTSW	11	86319365	missense	probably benign	0.09
R5556:Med13	UTSW	11	86327838	missense	probably benign	0.25
R5633:Med13	UTSW	11	86278931	splice site	probably benign
R5769:Med13	UTSW	11	86346003	missense	probably benign	0.11
R6236:Med13	UTSW	11	86328531	missense	probably damaging	0.99
R6479:Med13	UTSW	11	86357527	start gained	probably benign
R6487:Med13	UTSW	11	86331150	missense	probably damaging	1.00
R6524:Med13	UTSW	11	86301467	missense	probably damaging	0.98
R6528:Med13	UTSW	11	86298954	missense	probably damaging	1.00
R6913:Med13	UTSW	11	86319876	missense	probably benign
R7221:Med13	UTSW	11	86288095	missense	probably benign	0.00
R7254:Med13	UTSW	11	86319835	missense	probably benign
R7267:Med13	UTSW	11	86308826	missense	probably benign	0.01
R7309:Med13	UTSW	11	86291062	missense	probably benign	0.00
R7404:Med13	UTSW	11	86286446	missense	possibly damaging	0.53
R7586:Med13	UTSW	11	86271002	missense	probably damaging	0.99
R7704:Med13	UTSW	11	86345918	nonsense	probably null
R7922:Med13	UTSW	11	86271005	missense	probably damaging	0.98
R7943:Med13	UTSW	11	86278526	missense	probably damaging	0.97
R8062:Med13	UTSW	11	86319438	missense	probably benign
R8075:Med13	UTSW	11	86272470	missense	probably damaging	0.98
R8207:Med13	UTSW	11	86303549	missense	probably damaging	1.00
R8671:Med13	UTSW	11	86271097	missense	probably damaging	1.00
R9056:Med13	UTSW	11	86298834	nonsense	probably null
R9084:Med13	UTSW	11	86300795	missense	probably damaging	1.00
R9148:Med13	UTSW	11	86301471	missense	probably benign	0.27
R9329:Med13	UTSW	11	86298457	missense	probably benign	0.10
R9380:Med13	UTSW	11	86286772	missense	probably benign	0.42
R9515:Med13	UTSW	11	86308901	missense	probably benign	0.00
R9516:Med13	UTSW	11	86288975	missense	probably benign	0.01
R9690:Med13	UTSW	11	86278844	missense	probably damaging	1.00
R9751:Med13	UTSW	11	86299158	missense	probably damaging	1.00
R9752:Med13	UTSW	11	86283321	missense	possibly damaging	0.87
R9764:Med13	UTSW	11	86286519	missense	possibly damaging	0.89
Z1176:Med13	UTSW	11	86328544	missense	possibly damaging	0.91
Z1176:Med13	UTSW	11	86345862	missense	probably benign	0.45
Z1176:Med13	UTSW	11	86355423	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTTAGCTGAGGCGTCTGC -3'
(R):5'- TTCATCGTCAGTCTCATAACAGAGC -3'

Sequencing Primer
(F):5'- GAGTGGTACTTCTTCCAAAAACAG -3'
(R):5'- CAGAGCAGTAACTTTAAGTACTGTCC -3'

Posted On

2018-09-12