Incidental Mutation 'R6805:Jup'
ID533548
Institutional Source Beutler Lab
Gene Symbol Jup
Ensembl Gene ENSMUSG00000001552
Gene Namejunction plakoglobin
SynonymsPG, gamma-catenin, Ctnng, plakoglobin, D930025P04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6805 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location100368958-100397763 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100383458 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 135 (D135E)
Ref Sequence ENSEMBL: ENSMUSP00000103026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001592] [ENSMUST00000107403]
Predicted Effect probably benign
Transcript: ENSMUST00000001592
AA Change: D135E

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000001592
Gene: ENSMUSG00000001552
AA Change: D135E

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
ARM 132 171 3.58e1 SMART
ARM 172 214 4.03e1 SMART
ARM 215 255 1.07e-4 SMART
ARM 256 297 1.66e-1 SMART
ARM 299 340 1.86e1 SMART
ARM 341 381 9.23e-9 SMART
ARM 382 420 2.29e1 SMART
ARM 422 464 7.34e-3 SMART
ARM 469 510 8.3e-2 SMART
ARM 511 572 7.45e-4 SMART
ARM 573 613 5.35e-5 SMART
ARM 614 654 1.56e1 SMART
low complexity region 708 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107403
AA Change: D135E

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103026
Gene: ENSMUSG00000001552
AA Change: D135E

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
ARM 132 171 3.58e1 SMART
ARM 172 214 4.03e1 SMART
ARM 215 255 1.07e-4 SMART
ARM 256 297 1.66e-1 SMART
ARM 299 340 1.86e1 SMART
ARM 341 381 9.23e-9 SMART
ARM 382 420 2.29e1 SMART
ARM 422 464 7.34e-3 SMART
ARM 469 510 8.3e-2 SMART
ARM 511 572 7.45e-4 SMART
ARM 573 613 5.35e-5 SMART
ARM 614 654 1.56e1 SMART
low complexity region 708 723 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major cytoplasmic protein which is the only known constituent common to submembranous plaques of both desmosomes and intermediate junctions. This protein forms distinct complexes with cadherins and desmosomal cadherins and is a member of the catenin family since it contains a distinct repeating amino acid motif called the armadillo repeat. Mutation in this gene has been associated with Naxos disease. Alternative splicing occurs in this gene; however, not all transcripts have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die with severe heart defects at embryonic day 10.5-16, depending on genetic background. Mutants that survive to birth exhibit skin blistering and subcorneal acantholysis associated with reduced number of desmosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,306 V2591A probably benign Het
4930407I10Rik A G 15: 82,062,543 T214A possibly damaging Het
A930009A15Rik G T 10: 115,579,905 probably benign Het
Aadac A C 3: 60,037,336 D143A probably benign Het
Acot10 T G 15: 20,665,366 T430P probably benign Het
Adgrb3 T C 1: 25,826,172 T197A possibly damaging Het
B230118H07Rik T C 2: 101,566,459 K192E probably benign Het
Bbs1 A G 19: 4,900,615 I200T probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cadps G A 14: 12,467,103 A943V probably damaging Het
Cc2d2a A G 5: 43,681,331 E48G probably damaging Het
Clca1 A T 3: 145,018,667 C211S probably damaging Het
Col18a1 A G 10: 77,054,239 L1429P probably damaging Het
Cul2 T G 18: 3,421,263 Y196D probably damaging Het
D630023F18Rik T C 1: 65,117,206 S43G probably benign Het
Ddx39 G A 8: 83,723,137 R427Q probably damaging Het
Def6 A G 17: 28,223,717 T285A probably damaging Het
Defb21 T A 2: 152,574,869 D88E probably benign Het
Defb6 A G 8: 19,228,101 K63R probably benign Het
Dnph1 T C 17: 46,498,744 S112P probably damaging Het
Dock10 T A 1: 80,586,690 I467L probably benign Het
Dspp C A 5: 104,175,850 H286Q probably benign Het
Eya1 T A 1: 14,183,277 T459S probably benign Het
Faf1 T C 4: 109,861,852 L385P probably damaging Het
Fbxw21 C A 9: 109,157,565 R82L probably damaging Het
Fryl A G 5: 73,065,094 V2048A probably benign Het
Galnt5 A T 2: 58,035,299 D864V possibly damaging Het
Gata6 T G 18: 11,054,460 S130A possibly damaging Het
Gbf1 G T 19: 46,262,507 R434L probably damaging Het
Gga3 A G 11: 115,585,762 F709L probably damaging Het
Hcar1 A G 5: 123,879,130 V166A probably benign Het
Hexa T A 9: 59,563,937 N491K possibly damaging Het
Hpse2 A T 19: 43,294,321 C164* probably null Het
Ifi202b T C 1: 173,974,989 Y93C probably damaging Het
Iscu T A 5: 113,775,243 I79N probably damaging Het
Jmjd7 T A 2: 120,031,323 Y182* probably null Het
Kit T A 5: 75,652,808 I881N probably damaging Het
Llgl1 T A 11: 60,702,865 S55T probably benign Het
Lonp2 G A 8: 86,709,096 M653I probably benign Het
Lrp8 T C 4: 107,854,320 Y307H probably damaging Het
Med13 A T 11: 86,278,796 M1914K possibly damaging Het
Ms4a1 A G 19: 11,253,173 probably null Het
Naip1 A G 13: 100,427,341 S439P probably benign Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1129 T A 2: 87,574,918 probably null Het
Olfr835 G T 9: 19,035,301 M59I probably damaging Het
Pds5b T A 5: 150,805,561 probably null Het
Phf12 G A 11: 78,027,373 G804R probably damaging Het
Pou6f2 T C 13: 18,239,489 T234A Het
Prune2 A T 19: 17,120,590 I1153L probably benign Het
Ptprc C T 1: 138,067,885 probably null Het
Qpctl T C 7: 19,149,154 Q11R probably benign Het
Rfx4 A G 10: 84,840,228 K103E possibly damaging Het
Srcin1 T A 11: 97,551,980 probably null Het
St6galnac1 G T 11: 116,768,944 A181D probably damaging Het
Stk36 T C 1: 74,622,239 V475A probably benign Het
Tbc1d21 T C 9: 58,361,288 T263A possibly damaging Het
Tex24 A T 8: 27,345,000 K185N probably damaging Het
Tnxb T A 17: 34,698,153 V2174E possibly damaging Het
Tollip A G 7: 141,890,845 S57P probably benign Het
Zbtb49 A G 5: 38,213,241 probably benign Het
Zfp758 A G 17: 22,361,669 T30A probably benign Het
Other mutations in Jup
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Jup APN 11 100386249 missense probably benign
IGL01797:Jup APN 11 100381672 splice site probably benign
IGL01926:Jup APN 11 100383586 missense probably benign 0.00
IGL02030:Jup APN 11 100376991 missense probably damaging 0.96
IGL02073:Jup APN 11 100383389 splice site probably benign
IGL02218:Jup APN 11 100381839 missense probably damaging 1.00
IGL02450:Jup APN 11 100378357 missense probably damaging 1.00
IGL02955:Jup APN 11 100376739 missense probably benign 0.31
IGL02976:Jup APN 11 100378366 missense probably benign 0.40
IGL03023:Jup APN 11 100380692 splice site probably benign
IGL02802:Jup UTSW 11 100378378 missense probably benign
PIT4403001:Jup UTSW 11 100378087 critical splice donor site probably null
R0426:Jup UTSW 11 100372401 missense probably benign 0.02
R0626:Jup UTSW 11 100376763 missense probably benign
R1330:Jup UTSW 11 100372676 missense probably benign 0.02
R1437:Jup UTSW 11 100383576 missense probably benign 0.06
R1448:Jup UTSW 11 100383200 missense probably damaging 1.00
R1473:Jup UTSW 11 100379601 missense possibly damaging 0.79
R1686:Jup UTSW 11 100372434 missense probably damaging 0.96
R1824:Jup UTSW 11 100374137 nonsense probably null
R1875:Jup UTSW 11 100372294 unclassified probably null
R2017:Jup UTSW 11 100386341 missense probably benign 0.01
R2989:Jup UTSW 11 100376841 missense possibly damaging 0.92
R3881:Jup UTSW 11 100378381 missense probably benign
R3882:Jup UTSW 11 100378381 missense probably benign
R4176:Jup UTSW 11 100372461 missense probably benign 0.03
R4612:Jup UTSW 11 100381834 missense probably damaging 0.98
R4808:Jup UTSW 11 100378192 missense probably damaging 0.99
R4854:Jup UTSW 11 100383041 missense possibly damaging 0.73
R4995:Jup UTSW 11 100379541 nonsense probably null
R5133:Jup UTSW 11 100383115 missense probably benign 0.02
R5408:Jup UTSW 11 100376781 missense probably damaging 1.00
R5641:Jup UTSW 11 100376806 missense possibly damaging 0.62
R5991:Jup UTSW 11 100379569 missense possibly damaging 0.59
R6431:Jup UTSW 11 100374341 missense probably benign 0.01
R7022:Jup UTSW 11 100379553 missense probably damaging 1.00
R7203:Jup UTSW 11 100381734 missense probably damaging 1.00
R7399:Jup UTSW 11 100378351 missense possibly damaging 0.87
R7707:Jup UTSW 11 100383052 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTACCTGGAGGAAGTGTGTGAG -3'
(R):5'- TACCAGATGTCCACAACGGC -3'

Sequencing Primer
(F):5'- TGTGTGAGACCTTGAGCAGATAGC -3'
(R):5'- GATGTCCACAACGGCCAGAG -3'
Posted On2018-09-12