Mutagenetix > Incidental Mutation

Incidental Mutation 'R6805:Jup'

533548

Institutional Source

Beutler Lab

Gene Symbol

Jup

Ensembl Gene

ENSMUSG00000001552

Gene Name

junction plakoglobin

Synonyms

PG, gamma-catenin, Ctnng, plakoglobin, D930025P04Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6805 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100368958-100397763 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 100383458 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 135 (D135E)

Ref Sequence

ENSEMBL: ENSMUSP00000103026 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001592] [ENSMUST00000107403]

AlphaFold

Q02257

Predicted Effect

probably benign
Transcript: ENSMUST00000001592
AA Change: D135E

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000001592
Gene: ENSMUSG00000001552
AA Change: D135E

Domain	Start	End	E-Value	Type
low complexity region	52	63	N/A	INTRINSIC
ARM	132	171	3.58e1	SMART
ARM	172	214	4.03e1	SMART
ARM	215	255	1.07e-4	SMART
ARM	256	297	1.66e-1	SMART
ARM	299	340	1.86e1	SMART
ARM	341	381	9.23e-9	SMART
ARM	382	420	2.29e1	SMART
ARM	422	464	7.34e-3	SMART
ARM	469	510	8.3e-2	SMART
ARM	511	572	7.45e-4	SMART
ARM	573	613	5.35e-5	SMART
ARM	614	654	1.56e1	SMART
low complexity region	708	723	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107403
AA Change: D135E

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000103026
Gene: ENSMUSG00000001552
AA Change: D135E

Domain	Start	End	E-Value	Type
low complexity region	52	63	N/A	INTRINSIC
ARM	132	171	3.58e1	SMART
ARM	172	214	4.03e1	SMART
ARM	215	255	1.07e-4	SMART
ARM	256	297	1.66e-1	SMART
ARM	299	340	1.86e1	SMART
ARM	341	381	9.23e-9	SMART
ARM	382	420	2.29e1	SMART
ARM	422	464	7.34e-3	SMART
ARM	469	510	8.3e-2	SMART
ARM	511	572	7.45e-4	SMART
ARM	573	613	5.35e-5	SMART
ARM	614	654	1.56e1	SMART
low complexity region	708	723	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.8%
20x: 97.1%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major cytoplasmic protein which is the only known constituent common to submembranous plaques of both desmosomes and intermediate junctions. This protein forms distinct complexes with cadherins and desmosomal cadherins and is a member of the catenin family since it contains a distinct repeating amino acid motif called the armadillo repeat. Mutation in this gene has been associated with Naxos disease. Alternative splicing occurs in this gene; however, not all transcripts have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die with severe heart defects at embryonic day 10.5-16, depending on genetic background. Mutants that survive to birth exhibit skin blistering and subcorneal acantholysis associated with reduced number of desmosomes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,244,306	V2591A	probably benign	Het
4930407I10Rik	A	G	15: 82,062,543	T214A	possibly damaging	Het
A930009A15Rik	G	T	10: 115,579,905		probably benign	Het
Aadac	A	C	3: 60,037,336	D143A	probably benign	Het
Acot10	T	G	15: 20,665,366	T430P	probably benign	Het
Adgrb3	T	C	1: 25,826,172	T197A	possibly damaging	Het
B230118H07Rik	T	C	2: 101,566,459	K192E	probably benign	Het
Bbs1	A	G	19: 4,900,615	I200T	probably damaging	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
Cadps	G	A	14: 12,467,103	A943V	probably damaging	Het
Cc2d2a	A	G	5: 43,681,331	E48G	probably damaging	Het
Clca1	A	T	3: 145,018,667	C211S	probably damaging	Het
Col18a1	A	G	10: 77,054,239	L1429P	probably damaging	Het
Cul2	T	G	18: 3,421,263	Y196D	probably damaging	Het
D630023F18Rik	T	C	1: 65,117,206	S43G	probably benign	Het
Ddx39	G	A	8: 83,723,137	R427Q	probably damaging	Het
Def6	A	G	17: 28,223,717	T285A	probably damaging	Het
Defb21	T	A	2: 152,574,869	D88E	probably benign	Het
Defb6	A	G	8: 19,228,101	K63R	probably benign	Het
Dnph1	T	C	17: 46,498,744	S112P	probably damaging	Het
Dock10	T	A	1: 80,586,690	I467L	probably benign	Het
Dspp	C	A	5: 104,175,850	H286Q	probably benign	Het
Eya1	T	A	1: 14,183,277	T459S	probably benign	Het
Faf1	T	C	4: 109,861,852	L385P	probably damaging	Het
Fbxw21	C	A	9: 109,157,565	R82L	probably damaging	Het
Fryl	A	G	5: 73,065,094	V2048A	probably benign	Het
Galnt5	A	T	2: 58,035,299	D864V	possibly damaging	Het
Gata6	T	G	18: 11,054,460	S130A	possibly damaging	Het
Gbf1	G	T	19: 46,262,507	R434L	probably damaging	Het
Gga3	A	G	11: 115,585,762	F709L	probably damaging	Het
Hcar1	A	G	5: 123,879,130	V166A	probably benign	Het
Hexa	T	A	9: 59,563,937	N491K	possibly damaging	Het
Hpse2	A	T	19: 43,294,321	C164*	probably null	Het
Ifi202b	T	C	1: 173,974,989	Y93C	probably damaging	Het
Iscu	T	A	5: 113,775,243	I79N	probably damaging	Het
Jmjd7	T	A	2: 120,031,323	Y182*	probably null	Het
Kit	T	A	5: 75,652,808	I881N	probably damaging	Het
Llgl1	T	A	11: 60,702,865	S55T	probably benign	Het
Lonp2	G	A	8: 86,709,096	M653I	probably benign	Het
Lrp8	T	C	4: 107,854,320	Y307H	probably damaging	Het
Med13	A	T	11: 86,278,796	M1914K	possibly damaging	Het
Ms4a1	A	G	19: 11,253,173		probably null	Het
Naip1	A	G	13: 100,427,341	S439P	probably benign	Het
Nrg1	T	C	8: 31,821,264	R476G	probably damaging	Het
Olfr1129	T	A	2: 87,574,918		probably null	Het
Olfr835	G	T	9: 19,035,301	M59I	probably damaging	Het
Pds5b	T	A	5: 150,805,561		probably null	Het
Phf12	G	A	11: 78,027,373	G804R	probably damaging	Het
Pou6f2	T	C	13: 18,239,489	T234A		Het
Prune2	A	T	19: 17,120,590	I1153L	probably benign	Het
Ptprc	C	T	1: 138,067,885		probably null	Het
Qpctl	T	C	7: 19,149,154	Q11R	probably benign	Het
Rfx4	A	G	10: 84,840,228	K103E	possibly damaging	Het
Srcin1	T	A	11: 97,551,980		probably null	Het
St6galnac1	G	T	11: 116,768,944	A181D	probably damaging	Het
Stk36	T	C	1: 74,622,239	V475A	probably benign	Het
Tbc1d21	T	C	9: 58,361,288	T263A	possibly damaging	Het
Tex24	A	T	8: 27,345,000	K185N	probably damaging	Het
Tnxb	T	A	17: 34,698,153	V2174E	possibly damaging	Het
Tollip	A	G	7: 141,890,845	S57P	probably benign	Het
Zbtb49	A	G	5: 38,213,241		probably benign	Het
Zfp758	A	G	17: 22,361,669	T30A	probably benign	Het

Other mutations in Jup

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01141:Jup	APN	11	100386249	missense	probably benign
IGL01797:Jup	APN	11	100381672	splice site	probably benign
IGL01926:Jup	APN	11	100383586	missense	probably benign	0.00
IGL02030:Jup	APN	11	100376991	missense	probably damaging	0.96
IGL02073:Jup	APN	11	100383389	splice site	probably benign
IGL02218:Jup	APN	11	100381839	missense	probably damaging	1.00
IGL02450:Jup	APN	11	100378357	missense	probably damaging	1.00
IGL02955:Jup	APN	11	100376739	missense	probably benign	0.31
IGL02976:Jup	APN	11	100378366	missense	probably benign	0.40
IGL03023:Jup	APN	11	100380692	splice site	probably benign
Jove	UTSW	11	100386287	missense	probably damaging	1.00
IGL02802:Jup	UTSW	11	100378378	missense	probably benign
PIT4403001:Jup	UTSW	11	100378087	critical splice donor site	probably null
R0426:Jup	UTSW	11	100372401	missense	probably benign	0.02
R0626:Jup	UTSW	11	100376763	missense	probably benign
R1330:Jup	UTSW	11	100372676	missense	probably benign	0.02
R1437:Jup	UTSW	11	100383576	missense	probably benign	0.06
R1448:Jup	UTSW	11	100383200	missense	probably damaging	1.00
R1473:Jup	UTSW	11	100379601	missense	possibly damaging	0.79
R1686:Jup	UTSW	11	100372434	missense	probably damaging	0.96
R1824:Jup	UTSW	11	100374137	nonsense	probably null
R1875:Jup	UTSW	11	100372294	splice site	probably null
R2017:Jup	UTSW	11	100386341	missense	probably benign	0.01
R2989:Jup	UTSW	11	100376841	missense	possibly damaging	0.92
R3881:Jup	UTSW	11	100378381	missense	probably benign
R3882:Jup	UTSW	11	100378381	missense	probably benign
R4176:Jup	UTSW	11	100372461	missense	probably benign	0.03
R4612:Jup	UTSW	11	100381834	missense	probably damaging	0.98
R4808:Jup	UTSW	11	100378192	missense	probably damaging	0.99
R4854:Jup	UTSW	11	100383041	missense	possibly damaging	0.73
R4995:Jup	UTSW	11	100379541	nonsense	probably null
R5133:Jup	UTSW	11	100383115	missense	probably benign	0.02
R5408:Jup	UTSW	11	100376781	missense	probably damaging	1.00
R5641:Jup	UTSW	11	100376806	missense	possibly damaging	0.62
R5991:Jup	UTSW	11	100379569	missense	possibly damaging	0.59
R6431:Jup	UTSW	11	100374341	missense	probably benign	0.01
R7022:Jup	UTSW	11	100379553	missense	probably damaging	1.00
R7203:Jup	UTSW	11	100381734	missense	probably damaging	1.00
R7399:Jup	UTSW	11	100378351	missense	possibly damaging	0.87
R7707:Jup	UTSW	11	100383052	missense	possibly damaging	0.90
R8017:Jup	UTSW	11	100374197	missense	probably benign	0.34
R8019:Jup	UTSW	11	100374197	missense	probably benign	0.34
R8074:Jup	UTSW	11	100386287	missense	probably damaging	1.00
R8181:Jup	UTSW	11	100376925	missense	probably damaging	1.00
R8326:Jup	UTSW	11	100381745	missense	probably benign	0.33
R8969:Jup	UTSW	11	100379565	missense	probably damaging	1.00
R8970:Jup	UTSW	11	100379565	missense	probably damaging	1.00
R8971:Jup	UTSW	11	100379565	missense	probably damaging	1.00
R9139:Jup	UTSW	11	100379565	missense	probably damaging	1.00
R9140:Jup	UTSW	11	100379565	missense	probably damaging	1.00
R9145:Jup	UTSW	11	100378298	missense	probably benign	0.01
R9168:Jup	UTSW	11	100383393	critical splice donor site	probably null
R9370:Jup	UTSW	11	100379565	missense	probably damaging	1.00
R9372:Jup	UTSW	11	100379565	missense	probably damaging	1.00
R9373:Jup	UTSW	11	100379565	missense	probably damaging	1.00
R9381:Jup	UTSW	11	100379565	missense	probably damaging	1.00
R9506:Jup	UTSW	11	100376878	missense	probably damaging	1.00
R9685:Jup	UTSW	11	100383411	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTACCTGGAGGAAGTGTGTGAG -3'
(R):5'- TACCAGATGTCCACAACGGC -3'

Sequencing Primer
(F):5'- TGTGTGAGACCTTGAGCAGATAGC -3'
(R):5'- GATGTCCACAACGGCCAGAG -3'

Posted On

2018-09-12