Incidental Mutation 'R6805:Gga3'
ID 533549
Institutional Source Beutler Lab
Gene Symbol Gga3
Ensembl Gene ENSMUSG00000020740
Gene Name golgi associated, gamma adaptin ear containing, ARF binding protein 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.658) question?
Stock # R6805 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 115584255-115604051 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 115585762 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 709 (F709L)
Ref Sequence ENSEMBL: ENSMUSP00000019135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019135] [ENSMUST00000021085] [ENSMUST00000106508] [ENSMUST00000140986] [ENSMUST00000144473] [ENSMUST00000156173]
AlphaFold Q8BMI3
Predicted Effect probably damaging
Transcript: ENSMUST00000019135
AA Change: F709L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019135
Gene: ENSMUSG00000020740
AA Change: F709L

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 222 299 1.7e-20 PFAM
low complexity region 334 369 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
low complexity region 455 471 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Alpha_adaptinC2 586 710 6.09e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021085
SMART Domains Protein: ENSMUSP00000021085
Gene: ENSMUSG00000020739

DomainStartEndE-ValueType
Pfam:Nucleopor_Nup85 53 606 1.2e-181 PFAM
low complexity region 635 649 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106508
AA Change: F631L

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102117
Gene: ENSMUSG00000020740
AA Change: F631L

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 206 307 1.3e-32 PFAM
low complexity region 377 393 N/A INTRINSIC
low complexity region 405 420 N/A INTRINSIC
low complexity region 454 476 N/A INTRINSIC
Alpha_adaptinC2 508 632 6.09e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140986
SMART Domains Protein: ENSMUSP00000117333
Gene: ENSMUSG00000020739

DomainStartEndE-ValueType
Pfam:Nucleopor_Nup85 21 280 5.9e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144473
SMART Domains Protein: ENSMUSP00000116069
Gene: ENSMUSG00000020739

DomainStartEndE-ValueType
Pfam:Nucleopor_Nup85 1 170 3e-56 PFAM
Pfam:Nucleopor_Nup85 168 274 1.1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156173
SMART Domains Protein: ENSMUSP00000138597
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 206 307 7.3e-32 PFAM
low complexity region 334 369 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
low complexity region 455 471 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Meta Mutation Damage Score 0.5292 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Golgi-localized, gamma adaptin ear-containing, ARF-binding (GGA) family. This family includes ubiquitous coat proteins that regulate the trafficking of proteins between the trans-Golgi network and the lysosome. These proteins share an amino-terminal VHS domain which mediates sorting of the mannose 6-phosphate receptors at the trans-Golgi network. They also contain a carboxy-terminal region with homology to the ear domain of gamma-adaptins. Multiple alternatively spliced transcript variants have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene-trapped allele display decreased birth weight, slow postnatal weight gain, hypoglycemia, increased plasma levels of acid hydrolases, and partial neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,306 V2591A probably benign Het
4930407I10Rik A G 15: 82,062,543 T214A possibly damaging Het
A930009A15Rik G T 10: 115,579,905 probably benign Het
Aadac A C 3: 60,037,336 D143A probably benign Het
Acot10 T G 15: 20,665,366 T430P probably benign Het
Adgrb3 T C 1: 25,826,172 T197A possibly damaging Het
B230118H07Rik T C 2: 101,566,459 K192E probably benign Het
Bbs1 A G 19: 4,900,615 I200T probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cadps G A 14: 12,467,103 A943V probably damaging Het
Cc2d2a A G 5: 43,681,331 E48G probably damaging Het
Clca1 A T 3: 145,018,667 C211S probably damaging Het
Col18a1 A G 10: 77,054,239 L1429P probably damaging Het
Cul2 T G 18: 3,421,263 Y196D probably damaging Het
D630023F18Rik T C 1: 65,117,206 S43G probably benign Het
Ddx39 G A 8: 83,723,137 R427Q probably damaging Het
Def6 A G 17: 28,223,717 T285A probably damaging Het
Defb21 T A 2: 152,574,869 D88E probably benign Het
Defb6 A G 8: 19,228,101 K63R probably benign Het
Dnph1 T C 17: 46,498,744 S112P probably damaging Het
Dock10 T A 1: 80,586,690 I467L probably benign Het
Dspp C A 5: 104,175,850 H286Q probably benign Het
Eya1 T A 1: 14,183,277 T459S probably benign Het
Faf1 T C 4: 109,861,852 L385P probably damaging Het
Fbxw21 C A 9: 109,157,565 R82L probably damaging Het
Fryl A G 5: 73,065,094 V2048A probably benign Het
Galnt5 A T 2: 58,035,299 D864V possibly damaging Het
Gata6 T G 18: 11,054,460 S130A possibly damaging Het
Gbf1 G T 19: 46,262,507 R434L probably damaging Het
Hcar1 A G 5: 123,879,130 V166A probably benign Het
Hexa T A 9: 59,563,937 N491K possibly damaging Het
Hpse2 A T 19: 43,294,321 C164* probably null Het
Ifi202b T C 1: 173,974,989 Y93C probably damaging Het
Iscu T A 5: 113,775,243 I79N probably damaging Het
Jmjd7 T A 2: 120,031,323 Y182* probably null Het
Jup A T 11: 100,383,458 D135E probably benign Het
Kit T A 5: 75,652,808 I881N probably damaging Het
Llgl1 T A 11: 60,702,865 S55T probably benign Het
Lonp2 G A 8: 86,709,096 M653I probably benign Het
Lrp8 T C 4: 107,854,320 Y307H probably damaging Het
Med13 A T 11: 86,278,796 M1914K possibly damaging Het
Ms4a1 A G 19: 11,253,173 probably null Het
Naip1 A G 13: 100,427,341 S439P probably benign Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1129 T A 2: 87,574,918 probably null Het
Olfr835 G T 9: 19,035,301 M59I probably damaging Het
Pds5b T A 5: 150,805,561 probably null Het
Phf12 G A 11: 78,027,373 G804R probably damaging Het
Pou6f2 T C 13: 18,239,489 T234A Het
Prune2 A T 19: 17,120,590 I1153L probably benign Het
Ptprc C T 1: 138,067,885 probably null Het
Qpctl T C 7: 19,149,154 Q11R probably benign Het
Rfx4 A G 10: 84,840,228 K103E possibly damaging Het
Srcin1 T A 11: 97,551,980 probably null Het
St6galnac1 G T 11: 116,768,944 A181D probably damaging Het
Stk36 T C 1: 74,622,239 V475A probably benign Het
Tbc1d21 T C 9: 58,361,288 T263A possibly damaging Het
Tex24 A T 8: 27,345,000 K185N probably damaging Het
Tnxb T A 17: 34,698,153 V2174E possibly damaging Het
Tollip A G 7: 141,890,845 S57P probably benign Het
Zbtb49 A G 5: 38,213,241 probably benign Het
Zfp758 A G 17: 22,361,669 T30A probably benign Het
Other mutations in Gga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Gga3 APN 11 115591741 missense probably damaging 1.00
IGL01449:Gga3 APN 11 115589102 missense probably damaging 1.00
IGL03343:Gga3 APN 11 115592486 missense probably damaging 0.99
IGL03390:Gga3 APN 11 115586994 critical splice donor site probably null
R0049:Gga3 UTSW 11 115587089 nonsense probably null
R0133:Gga3 UTSW 11 115588979 splice site probably benign
R0411:Gga3 UTSW 11 115587433 missense probably damaging 1.00
R0432:Gga3 UTSW 11 115590524 missense probably damaging 1.00
R0865:Gga3 UTSW 11 115592459 missense probably damaging 1.00
R3852:Gga3 UTSW 11 115587542 missense probably benign 0.04
R4869:Gga3 UTSW 11 115586285 intron probably benign
R4878:Gga3 UTSW 11 115591321 missense probably damaging 1.00
R5380:Gga3 UTSW 11 115588431 missense probably damaging 1.00
R5527:Gga3 UTSW 11 115587436 missense probably damaging 0.98
R6545:Gga3 UTSW 11 115587169 missense possibly damaging 0.71
R6967:Gga3 UTSW 11 115591276 missense probably damaging 1.00
R8311:Gga3 UTSW 11 115587008 missense probably benign 0.19
R8670:Gga3 UTSW 11 115587716 missense probably benign 0.08
R8837:Gga3 UTSW 11 115588479 missense probably benign
R8852:Gga3 UTSW 11 115590418 missense probably benign 0.08
R8860:Gga3 UTSW 11 115590418 missense probably benign 0.08
R9587:Gga3 UTSW 11 115590891 missense probably damaging 1.00
Z1176:Gga3 UTSW 11 115587603 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGACAGGTCCTTTTAGGGGC -3'
(R):5'- CAAGATGGATCCTTCCTGGC -3'

Sequencing Primer
(F):5'- TCCTTTTAGGGGCCCAGGAAG -3'
(R):5'- AGATGGATCCTTCCTGGCAGAATC -3'
Posted On 2018-09-12