Incidental Mutation 'R6805:St6galnac1'
ID533550
Institutional Source Beutler Lab
Gene Symbol St6galnac1
Ensembl Gene ENSMUSG00000009588
Gene NameST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
SynonymsSiat7a, ST6GalNAc I
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6805 (G1)
Quality Score100.008
Status Not validated
Chromosome11
Chromosomal Location116765025-116775507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 116768944 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 181 (A181D)
Ref Sequence ENSEMBL: ENSMUSP00000009732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009732]
Predicted Effect probably damaging
Transcript: ENSMUST00000009732
AA Change: A181D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000009732
Gene: ENSMUSG00000009588
AA Change: A181D

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:Glyco_transf_29 230 518 2.9e-72 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosylation of proteins affects cell-cell interaction, interactions with the matrix, and the functions of intracellular molecules. ST6GALNAC1 transfers a sialic acid, N-acetylneuraminic acid (NeuAc), in an alpha-2,6 linkage to O-linked GalNAc residues. The cancer-associated sialyl-Tn (sTn) antigen is formed by ST6GALNAC1-catalyzed sialylation of GalNAc residues on mucins (Ikehara et al., 1999 [PubMed 10536037]; Sewell et al., 2006 [PubMed 16319059]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,306 V2591A probably benign Het
4930407I10Rik A G 15: 82,062,543 T214A possibly damaging Het
A930009A15Rik G T 10: 115,579,905 probably benign Het
Aadac A C 3: 60,037,336 D143A probably benign Het
Acot10 T G 15: 20,665,366 T430P probably benign Het
Adgrb3 T C 1: 25,826,172 T197A possibly damaging Het
B230118H07Rik T C 2: 101,566,459 K192E probably benign Het
Bbs1 A G 19: 4,900,615 I200T probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cadps G A 14: 12,467,103 A943V probably damaging Het
Cc2d2a A G 5: 43,681,331 E48G probably damaging Het
Clca1 A T 3: 145,018,667 C211S probably damaging Het
Col18a1 A G 10: 77,054,239 L1429P probably damaging Het
Cul2 T G 18: 3,421,263 Y196D probably damaging Het
D630023F18Rik T C 1: 65,117,206 S43G probably benign Het
Ddx39 G A 8: 83,723,137 R427Q probably damaging Het
Def6 A G 17: 28,223,717 T285A probably damaging Het
Defb21 T A 2: 152,574,869 D88E probably benign Het
Defb6 A G 8: 19,228,101 K63R probably benign Het
Dnph1 T C 17: 46,498,744 S112P probably damaging Het
Dock10 T A 1: 80,586,690 I467L probably benign Het
Dspp C A 5: 104,175,850 H286Q probably benign Het
Eya1 T A 1: 14,183,277 T459S probably benign Het
Faf1 T C 4: 109,861,852 L385P probably damaging Het
Fbxw21 C A 9: 109,157,565 R82L probably damaging Het
Fryl A G 5: 73,065,094 V2048A probably benign Het
Galnt5 A T 2: 58,035,299 D864V possibly damaging Het
Gata6 T G 18: 11,054,460 S130A possibly damaging Het
Gbf1 G T 19: 46,262,507 R434L probably damaging Het
Gga3 A G 11: 115,585,762 F709L probably damaging Het
Hcar1 A G 5: 123,879,130 V166A probably benign Het
Hexa T A 9: 59,563,937 N491K possibly damaging Het
Hpse2 A T 19: 43,294,321 C164* probably null Het
Ifi202b T C 1: 173,974,989 Y93C probably damaging Het
Iscu T A 5: 113,775,243 I79N probably damaging Het
Jmjd7 T A 2: 120,031,323 Y182* probably null Het
Jup A T 11: 100,383,458 D135E probably benign Het
Kit T A 5: 75,652,808 I881N probably damaging Het
Llgl1 T A 11: 60,702,865 S55T probably benign Het
Lonp2 G A 8: 86,709,096 M653I probably benign Het
Lrp8 T C 4: 107,854,320 Y307H probably damaging Het
Med13 A T 11: 86,278,796 M1914K possibly damaging Het
Ms4a1 A G 19: 11,253,173 probably null Het
Naip1 A G 13: 100,427,341 S439P probably benign Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1129 T A 2: 87,574,918 probably null Het
Olfr835 G T 9: 19,035,301 M59I probably damaging Het
Pds5b T A 5: 150,805,561 probably null Het
Phf12 G A 11: 78,027,373 G804R probably damaging Het
Pou6f2 T C 13: 18,239,489 T234A Het
Prune2 A T 19: 17,120,590 I1153L probably benign Het
Ptprc C T 1: 138,067,885 probably null Het
Qpctl T C 7: 19,149,154 Q11R probably benign Het
Rfx4 A G 10: 84,840,228 K103E possibly damaging Het
Srcin1 T A 11: 97,551,980 probably null Het
Stk36 T C 1: 74,622,239 V475A probably benign Het
Tbc1d21 T C 9: 58,361,288 T263A possibly damaging Het
Tex24 A T 8: 27,345,000 K185N probably damaging Het
Tnxb T A 17: 34,698,153 V2174E possibly damaging Het
Tollip A G 7: 141,890,845 S57P probably benign Het
Zbtb49 A G 5: 38,213,241 probably benign Het
Zfp758 A G 17: 22,361,669 T30A probably benign Het
Other mutations in St6galnac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:St6galnac1 APN 11 116767706 missense probably damaging 1.00
IGL01451:St6galnac1 APN 11 116769339 missense probably benign 0.00
IGL01873:St6galnac1 APN 11 116766611 missense probably damaging 0.98
IGL02569:St6galnac1 APN 11 116767702 missense probably damaging 1.00
IGL02799:St6galnac1 APN 11 116766647 splice site probably benign
IGL02935:St6galnac1 APN 11 116769345 missense probably benign
IGL03124:St6galnac1 APN 11 116775299 missense probably benign 0.00
PIT4520001:St6galnac1 UTSW 11 116769349 missense probably benign 0.00
R0126:St6galnac1 UTSW 11 116766584 missense probably benign 0.00
R0363:St6galnac1 UTSW 11 116768930 missense probably benign 0.36
R0394:St6galnac1 UTSW 11 116766640 missense probably damaging 0.99
R0828:St6galnac1 UTSW 11 116768997 missense probably benign 0.05
R1569:St6galnac1 UTSW 11 116769271 missense possibly damaging 0.46
R1570:St6galnac1 UTSW 11 116766648 splice site probably benign
R1591:St6galnac1 UTSW 11 116765863 missense probably damaging 1.00
R1602:St6galnac1 UTSW 11 116769287 missense probably benign 0.00
R2088:St6galnac1 UTSW 11 116769107 missense probably benign 0.00
R2212:St6galnac1 UTSW 11 116765856 missense probably damaging 1.00
R2266:St6galnac1 UTSW 11 116767847 nonsense probably null
R3413:St6galnac1 UTSW 11 116765856 missense probably damaging 1.00
R3835:St6galnac1 UTSW 11 116766283 missense probably damaging 1.00
R5016:St6galnac1 UTSW 11 116765880 missense probably damaging 1.00
R5446:St6galnac1 UTSW 11 116766269 missense probably benign 0.37
R6625:St6galnac1 UTSW 11 116765891 missense probably damaging 1.00
R7007:St6galnac1 UTSW 11 116767007 nonsense probably null
R7133:St6galnac1 UTSW 11 116767073 missense possibly damaging 0.89
R7491:St6galnac1 UTSW 11 116769184 missense probably benign 0.14
R7724:St6galnac1 UTSW 11 116766072 critical splice donor site probably null
R7812:St6galnac1 UTSW 11 116769101 missense probably benign 0.16
R8160:St6galnac1 UTSW 11 116775490 start gained probably benign
Z1177:St6galnac1 UTSW 11 116775428 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CAGACCTTAATCCTGGACCTAC -3'
(R):5'- CAAAGACGCCTGTGTCAGAAC -3'

Sequencing Primer
(F):5'- CCCTGACTTTGGCTGTTATAAAAAGG -3'
(R):5'- TGTCAGAACACCTGGACAAAC -3'
Posted On2018-09-12