Incidental Mutation 'R6805:St6galnac1'
ID 533550
Institutional Source Beutler Lab
Gene Symbol St6galnac1
Ensembl Gene ENSMUSG00000009588
Gene Name ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
Synonyms Siat7a, ST6GalNAc I
MMRRC Submission 044918-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R6805 (G1)
Quality Score 100.008
Status Not validated
Chromosome 11
Chromosomal Location 116655851-116666333 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 116659770 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 181 (A181D)
Ref Sequence ENSEMBL: ENSMUSP00000009732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009732]
AlphaFold Q9QZ39
Predicted Effect probably damaging
Transcript: ENSMUST00000009732
AA Change: A181D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000009732
Gene: ENSMUSG00000009588
AA Change: A181D

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:Glyco_transf_29 230 518 2.9e-72 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosylation of proteins affects cell-cell interaction, interactions with the matrix, and the functions of intracellular molecules. ST6GALNAC1 transfers a sialic acid, N-acetylneuraminic acid (NeuAc), in an alpha-2,6 linkage to O-linked GalNAc residues. The cancer-associated sialyl-Tn (sTn) antigen is formed by ST6GALNAC1-catalyzed sialylation of GalNAc residues on mucins (Ikehara et al., 1999 [PubMed 10536037]; Sewell et al., 2006 [PubMed 16319059]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 81,946,744 (GRCm39) T214A possibly damaging Het
A930009A15Rik G T 10: 115,415,810 (GRCm39) probably benign Het
Aadac A C 3: 59,944,757 (GRCm39) D143A probably benign Het
Acot10 T G 15: 20,665,452 (GRCm39) T430P probably benign Het
Adgrb3 T C 1: 25,865,253 (GRCm39) T197A possibly damaging Het
Bbs1 A G 19: 4,950,643 (GRCm39) I200T probably damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Cadps G A 14: 12,467,103 (GRCm38) A943V probably damaging Het
Cc2d2a A G 5: 43,838,673 (GRCm39) E48G probably damaging Het
Clca3a1 A T 3: 144,724,428 (GRCm39) C211S probably damaging Het
Col18a1 A G 10: 76,890,073 (GRCm39) L1429P probably damaging Het
Cplane1 T C 15: 8,273,790 (GRCm39) V2591A probably benign Het
Cul2 T G 18: 3,421,263 (GRCm39) Y196D probably damaging Het
D630023F18Rik T C 1: 65,156,365 (GRCm39) S43G probably benign Het
Ddx39a G A 8: 84,449,766 (GRCm39) R427Q probably damaging Het
Def6 A G 17: 28,442,691 (GRCm39) T285A probably damaging Het
Defb21 T A 2: 152,416,789 (GRCm39) D88E probably benign Het
Defb6 A G 8: 19,278,117 (GRCm39) K63R probably benign Het
Dnph1 T C 17: 46,809,670 (GRCm39) S112P probably damaging Het
Dock10 T A 1: 80,564,407 (GRCm39) I467L probably benign Het
Dspp C A 5: 104,323,716 (GRCm39) H286Q probably benign Het
Eya1 T A 1: 14,253,501 (GRCm39) T459S probably benign Het
Faf1 T C 4: 109,719,049 (GRCm39) L385P probably damaging Het
Fbxw21 C A 9: 108,986,633 (GRCm39) R82L probably damaging Het
Fryl A G 5: 73,222,437 (GRCm39) V2048A probably benign Het
Galnt5 A T 2: 57,925,311 (GRCm39) D864V possibly damaging Het
Gata6 T G 18: 11,054,460 (GRCm39) S130A possibly damaging Het
Gbf1 G T 19: 46,250,946 (GRCm39) R434L probably damaging Het
Gga3 A G 11: 115,476,588 (GRCm39) F709L probably damaging Het
Hcar1 A G 5: 124,017,193 (GRCm39) V166A probably benign Het
Hexa T A 9: 59,471,220 (GRCm39) N491K possibly damaging Het
Hpse2 A T 19: 43,282,760 (GRCm39) C164* probably null Het
Ifi202b T C 1: 173,802,555 (GRCm39) Y93C probably damaging Het
Iftap T C 2: 101,396,804 (GRCm39) K192E probably benign Het
Iscu T A 5: 113,913,304 (GRCm39) I79N probably damaging Het
Jmjd7 T A 2: 119,861,804 (GRCm39) Y182* probably null Het
Jup A T 11: 100,274,284 (GRCm39) D135E probably benign Het
Kit T A 5: 75,813,468 (GRCm39) I881N probably damaging Het
Llgl1 T A 11: 60,593,691 (GRCm39) S55T probably benign Het
Lonp2 G A 8: 87,435,724 (GRCm39) M653I probably benign Het
Lrp8 T C 4: 107,711,517 (GRCm39) Y307H probably damaging Het
Med13 A T 11: 86,169,622 (GRCm39) M1914K possibly damaging Het
Ms4a1 A G 19: 11,230,537 (GRCm39) probably null Het
Naip1 A G 13: 100,563,849 (GRCm39) S439P probably benign Het
Nrg1 T C 8: 32,311,292 (GRCm39) R476G probably damaging Het
Or10ag59 T A 2: 87,405,262 (GRCm39) probably null Het
Or7g20 G T 9: 18,946,597 (GRCm39) M59I probably damaging Het
Pds5b T A 5: 150,729,026 (GRCm39) probably null Het
Phf12 G A 11: 77,918,199 (GRCm39) G804R probably damaging Het
Pou6f2 T C 13: 18,414,074 (GRCm39) T234A Het
Prune2 A T 19: 17,097,954 (GRCm39) I1153L probably benign Het
Ptprc C T 1: 137,995,623 (GRCm39) probably null Het
Qpctl T C 7: 18,883,079 (GRCm39) Q11R probably benign Het
Rfx4 A G 10: 84,676,092 (GRCm39) K103E possibly damaging Het
Srcin1 T A 11: 97,442,806 (GRCm39) probably null Het
Stk36 T C 1: 74,661,398 (GRCm39) V475A probably benign Het
Tbc1d21 T C 9: 58,268,571 (GRCm39) T263A possibly damaging Het
Tex24 A T 8: 27,835,028 (GRCm39) K185N probably damaging Het
Tnxb T A 17: 34,917,127 (GRCm39) V2174E possibly damaging Het
Tollip A G 7: 141,444,582 (GRCm39) S57P probably benign Het
Zbtb49 A G 5: 38,370,585 (GRCm39) probably benign Het
Zfp758 A G 17: 22,580,650 (GRCm39) T30A probably benign Het
Other mutations in St6galnac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:St6galnac1 APN 11 116,658,532 (GRCm39) missense probably damaging 1.00
IGL01451:St6galnac1 APN 11 116,660,165 (GRCm39) missense probably benign 0.00
IGL01873:St6galnac1 APN 11 116,657,437 (GRCm39) missense probably damaging 0.98
IGL02569:St6galnac1 APN 11 116,658,528 (GRCm39) missense probably damaging 1.00
IGL02799:St6galnac1 APN 11 116,657,473 (GRCm39) splice site probably benign
IGL02935:St6galnac1 APN 11 116,660,171 (GRCm39) missense probably benign
IGL03124:St6galnac1 APN 11 116,666,125 (GRCm39) missense probably benign 0.00
PIT4520001:St6galnac1 UTSW 11 116,660,175 (GRCm39) missense probably benign 0.00
R0126:St6galnac1 UTSW 11 116,657,410 (GRCm39) missense probably benign 0.00
R0363:St6galnac1 UTSW 11 116,659,756 (GRCm39) missense probably benign 0.36
R0394:St6galnac1 UTSW 11 116,657,466 (GRCm39) missense probably damaging 0.99
R0828:St6galnac1 UTSW 11 116,659,823 (GRCm39) missense probably benign 0.05
R1569:St6galnac1 UTSW 11 116,660,097 (GRCm39) missense possibly damaging 0.46
R1570:St6galnac1 UTSW 11 116,657,474 (GRCm39) splice site probably benign
R1591:St6galnac1 UTSW 11 116,656,689 (GRCm39) missense probably damaging 1.00
R1602:St6galnac1 UTSW 11 116,660,113 (GRCm39) missense probably benign 0.00
R2088:St6galnac1 UTSW 11 116,659,933 (GRCm39) missense probably benign 0.00
R2212:St6galnac1 UTSW 11 116,656,682 (GRCm39) missense probably damaging 1.00
R2266:St6galnac1 UTSW 11 116,658,673 (GRCm39) nonsense probably null
R3413:St6galnac1 UTSW 11 116,656,682 (GRCm39) missense probably damaging 1.00
R3835:St6galnac1 UTSW 11 116,657,109 (GRCm39) missense probably damaging 1.00
R5016:St6galnac1 UTSW 11 116,656,706 (GRCm39) missense probably damaging 1.00
R5446:St6galnac1 UTSW 11 116,657,095 (GRCm39) missense probably benign 0.37
R6625:St6galnac1 UTSW 11 116,656,717 (GRCm39) missense probably damaging 1.00
R7007:St6galnac1 UTSW 11 116,657,833 (GRCm39) nonsense probably null
R7133:St6galnac1 UTSW 11 116,657,899 (GRCm39) missense possibly damaging 0.89
R7491:St6galnac1 UTSW 11 116,660,010 (GRCm39) missense probably benign 0.14
R7724:St6galnac1 UTSW 11 116,656,898 (GRCm39) critical splice donor site probably null
R7812:St6galnac1 UTSW 11 116,659,927 (GRCm39) missense probably benign 0.16
R8160:St6galnac1 UTSW 11 116,666,316 (GRCm39) start gained probably benign
R8341:St6galnac1 UTSW 11 116,659,714 (GRCm39) missense probably benign 0.00
R8373:St6galnac1 UTSW 11 116,660,059 (GRCm39) missense possibly damaging 0.62
R8379:St6galnac1 UTSW 11 116,666,325 (GRCm39) start gained probably benign
R8524:St6galnac1 UTSW 11 116,658,547 (GRCm39) missense possibly damaging 0.69
Z1177:St6galnac1 UTSW 11 116,666,254 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- CAGACCTTAATCCTGGACCTAC -3'
(R):5'- CAAAGACGCCTGTGTCAGAAC -3'

Sequencing Primer
(F):5'- CCCTGACTTTGGCTGTTATAAAAAGG -3'
(R):5'- TGTCAGAACACCTGGACAAAC -3'
Posted On 2018-09-12