Incidental Mutation 'R6805:Zfp758'
ID 533557
Institutional Source Beutler Lab
Gene Symbol Zfp758
Ensembl Gene ENSMUSG00000044501
Gene Name zinc finger protein 758
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock # R6805 (G1)
Quality Score 116.008
Status Validated
Chromosome 17
Chromosomal Location 22361453-22377281 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 22361669 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 30 (T30A)
Ref Sequence ENSEMBL: ENSMUSP00000121288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072477] [ENSMUST00000088765] [ENSMUST00000115535] [ENSMUST00000121315] [ENSMUST00000149699]
AlphaFold E9QAA1
Predicted Effect probably benign
Transcript: ENSMUST00000072477
SMART Domains Protein: ENSMUSP00000072298
Gene: ENSMUSG00000044501

DomainStartEndE-ValueType
KRAB 13 73 1.55e-20 SMART
ZnF_C2H2 177 199 6.92e0 SMART
ZnF_C2H2 205 227 6.32e-3 SMART
ZnF_C2H2 233 255 1.2e-3 SMART
ZnF_C2H2 261 283 9.08e-4 SMART
ZnF_C2H2 289 311 6.08e-5 SMART
ZnF_C2H2 317 339 1.03e-2 SMART
ZnF_C2H2 345 367 2.24e-3 SMART
ZnF_C2H2 373 395 3.21e-4 SMART
ZnF_C2H2 401 423 6.32e-3 SMART
ZnF_C2H2 429 451 2.24e-3 SMART
ZnF_C2H2 457 479 5.14e-3 SMART
ZnF_C2H2 485 507 1.04e-3 SMART
ZnF_C2H2 513 535 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088765
SMART Domains Protein: ENSMUSP00000086143
Gene: ENSMUSG00000044501

DomainStartEndE-ValueType
KRAB 13 73 1.55e-20 SMART
ZnF_C2H2 177 199 6.92e0 SMART
ZnF_C2H2 205 227 6.32e-3 SMART
ZnF_C2H2 233 255 1.2e-3 SMART
ZnF_C2H2 261 283 9.08e-4 SMART
ZnF_C2H2 289 311 6.08e-5 SMART
ZnF_C2H2 317 339 1.03e-2 SMART
ZnF_C2H2 345 367 2.24e-3 SMART
ZnF_C2H2 373 395 3.21e-4 SMART
ZnF_C2H2 401 423 6.32e-3 SMART
ZnF_C2H2 429 451 2.24e-3 SMART
ZnF_C2H2 457 479 5.14e-3 SMART
ZnF_C2H2 485 507 1.04e-3 SMART
ZnF_C2H2 513 535 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115535
SMART Domains Protein: ENSMUSP00000111197
Gene: ENSMUSG00000033972

DomainStartEndE-ValueType
KRAB 13 76 2.08e-21 SMART
ZnF_C2H2 183 205 1.01e-1 SMART
ZnF_C2H2 211 233 1.07e0 SMART
ZnF_C2H2 239 261 1.95e-3 SMART
ZnF_C2H2 267 289 1.22e-4 SMART
ZnF_C2H2 295 317 2.24e-3 SMART
ZnF_C2H2 323 345 1.82e-3 SMART
ZnF_C2H2 351 373 5.99e-4 SMART
ZnF_C2H2 379 401 4.79e-3 SMART
ZnF_C2H2 407 429 2.99e-4 SMART
ZnF_C2H2 435 457 4.17e-3 SMART
ZnF_C2H2 463 485 1.36e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121315
SMART Domains Protein: ENSMUSP00000113532
Gene: ENSMUSG00000044501

DomainStartEndE-ValueType
KRAB 13 73 1.55e-20 SMART
ZnF_C2H2 177 199 6.92e0 SMART
ZnF_C2H2 205 227 6.32e-3 SMART
ZnF_C2H2 233 255 1.2e-3 SMART
ZnF_C2H2 261 283 9.08e-4 SMART
ZnF_C2H2 289 311 6.08e-5 SMART
ZnF_C2H2 317 339 1.03e-2 SMART
ZnF_C2H2 345 367 2.24e-3 SMART
ZnF_C2H2 373 395 3.21e-4 SMART
ZnF_C2H2 401 423 6.32e-3 SMART
ZnF_C2H2 429 451 2.24e-3 SMART
ZnF_C2H2 457 479 5.14e-3 SMART
ZnF_C2H2 485 507 1.04e-3 SMART
ZnF_C2H2 513 535 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149699
AA Change: T30A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121288
Gene: ENSMUSG00000044501
AA Change: T30A

DomainStartEndE-ValueType
KRAB 45 105 1.55e-20 SMART
ZnF_C2H2 209 231 6.92e0 SMART
ZnF_C2H2 237 259 6.32e-3 SMART
ZnF_C2H2 265 287 1.2e-3 SMART
ZnF_C2H2 293 315 9.08e-4 SMART
ZnF_C2H2 321 343 6.08e-5 SMART
ZnF_C2H2 349 371 1.03e-2 SMART
ZnF_C2H2 377 399 2.24e-3 SMART
ZnF_C2H2 405 427 3.21e-4 SMART
ZnF_C2H2 433 455 6.32e-3 SMART
ZnF_C2H2 461 483 2.24e-3 SMART
ZnF_C2H2 489 511 5.14e-3 SMART
ZnF_C2H2 517 539 1.04e-3 SMART
ZnF_C2H2 545 567 4.4e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,306 V2591A probably benign Het
4930407I10Rik A G 15: 82,062,543 T214A possibly damaging Het
A930009A15Rik G T 10: 115,579,905 probably benign Het
Aadac A C 3: 60,037,336 D143A probably benign Het
Acot10 T G 15: 20,665,366 T430P probably benign Het
Adgrb3 T C 1: 25,826,172 T197A possibly damaging Het
B230118H07Rik T C 2: 101,566,459 K192E probably benign Het
Bbs1 A G 19: 4,900,615 I200T probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cadps G A 14: 12,467,103 A943V probably damaging Het
Cc2d2a A G 5: 43,681,331 E48G probably damaging Het
Clca1 A T 3: 145,018,667 C211S probably damaging Het
Col18a1 A G 10: 77,054,239 L1429P probably damaging Het
Cul2 T G 18: 3,421,263 Y196D probably damaging Het
D630023F18Rik T C 1: 65,117,206 S43G probably benign Het
Ddx39 G A 8: 83,723,137 R427Q probably damaging Het
Def6 A G 17: 28,223,717 T285A probably damaging Het
Defb21 T A 2: 152,574,869 D88E probably benign Het
Defb6 A G 8: 19,228,101 K63R probably benign Het
Dnph1 T C 17: 46,498,744 S112P probably damaging Het
Dock10 T A 1: 80,586,690 I467L probably benign Het
Dspp C A 5: 104,175,850 H286Q probably benign Het
Eya1 T A 1: 14,183,277 T459S probably benign Het
Faf1 T C 4: 109,861,852 L385P probably damaging Het
Fbxw21 C A 9: 109,157,565 R82L probably damaging Het
Fryl A G 5: 73,065,094 V2048A probably benign Het
Galnt5 A T 2: 58,035,299 D864V possibly damaging Het
Gata6 T G 18: 11,054,460 S130A possibly damaging Het
Gbf1 G T 19: 46,262,507 R434L probably damaging Het
Gga3 A G 11: 115,585,762 F709L probably damaging Het
Hcar1 A G 5: 123,879,130 V166A probably benign Het
Hexa T A 9: 59,563,937 N491K possibly damaging Het
Hpse2 A T 19: 43,294,321 C164* probably null Het
Ifi202b T C 1: 173,974,989 Y93C probably damaging Het
Iscu T A 5: 113,775,243 I79N probably damaging Het
Jmjd7 T A 2: 120,031,323 Y182* probably null Het
Jup A T 11: 100,383,458 D135E probably benign Het
Kit T A 5: 75,652,808 I881N probably damaging Het
Llgl1 T A 11: 60,702,865 S55T probably benign Het
Lonp2 G A 8: 86,709,096 M653I probably benign Het
Lrp8 T C 4: 107,854,320 Y307H probably damaging Het
Med13 A T 11: 86,278,796 M1914K possibly damaging Het
Ms4a1 A G 19: 11,253,173 probably null Het
Naip1 A G 13: 100,427,341 S439P probably benign Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1129 T A 2: 87,574,918 probably null Het
Olfr835 G T 9: 19,035,301 M59I probably damaging Het
Pds5b T A 5: 150,805,561 probably null Het
Phf12 G A 11: 78,027,373 G804R probably damaging Het
Pou6f2 T C 13: 18,239,489 T234A Het
Prune2 A T 19: 17,120,590 I1153L probably benign Het
Ptprc C T 1: 138,067,885 probably null Het
Qpctl T C 7: 19,149,154 Q11R probably benign Het
Rfx4 A G 10: 84,840,228 K103E possibly damaging Het
Srcin1 T A 11: 97,551,980 probably null Het
St6galnac1 G T 11: 116,768,944 A181D probably damaging Het
Stk36 T C 1: 74,622,239 V475A probably benign Het
Tbc1d21 T C 9: 58,361,288 T263A possibly damaging Het
Tex24 A T 8: 27,345,000 K185N probably damaging Het
Tnxb T A 17: 34,698,153 V2174E possibly damaging Het
Tollip A G 7: 141,890,845 S57P probably benign Het
Zbtb49 A G 5: 38,213,241 probably benign Het
Other mutations in Zfp758
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:Zfp758 APN 17 22375040 missense probably damaging 1.00
R1034:Zfp758 UTSW 17 22375759 nonsense probably null
R1187:Zfp758 UTSW 17 22375190 missense probably benign 0.23
R1733:Zfp758 UTSW 17 22375849 missense probably damaging 1.00
R1847:Zfp758 UTSW 17 22375223 missense probably benign 0.19
R1927:Zfp758 UTSW 17 22375842 missense probably damaging 0.99
R1934:Zfp758 UTSW 17 22373652 missense probably damaging 0.99
R2113:Zfp758 UTSW 17 22361645 missense probably benign 0.10
R2132:Zfp758 UTSW 17 22375970 missense probably damaging 1.00
R5134:Zfp758 UTSW 17 22375405 missense probably damaging 1.00
R5274:Zfp758 UTSW 17 22375855 missense probably benign 0.31
R5303:Zfp758 UTSW 17 22374861 missense probably benign 0.05
R5394:Zfp758 UTSW 17 22372068 missense probably damaging 0.99
R5813:Zfp758 UTSW 17 22375815 missense probably damaging 1.00
R6017:Zfp758 UTSW 17 22373731 missense probably damaging 1.00
R6411:Zfp758 UTSW 17 22375094 missense possibly damaging 0.85
R6501:Zfp758 UTSW 17 22371997 intron probably benign
R7076:Zfp758 UTSW 17 22375156 missense probably benign 0.11
R7147:Zfp758 UTSW 17 22376000 missense possibly damaging 0.75
R7170:Zfp758 UTSW 17 22375135 nonsense probably null
R7572:Zfp758 UTSW 17 22374891 missense possibly damaging 0.61
R7593:Zfp758 UTSW 17 22374958 missense probably damaging 0.98
R7699:Zfp758 UTSW 17 22375665 nonsense probably null
R7858:Zfp758 UTSW 17 22375378 missense probably benign 0.02
R9377:Zfp758 UTSW 17 22374944 missense probably benign 0.35
R9717:Zfp758 UTSW 17 22374848 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TCCTTAATTACGTTGGTAGAGTCC -3'
(R):5'- CCAACTGTTCATAAGATCTCAACTTCC -3'

Sequencing Primer
(F):5'- AATTACGTTGGTAGAGTCCGTCCAG -3'
(R):5'- TTCCTGACAACTGTAAGAGATCC -3'
Posted On 2018-09-12