Incidental Mutation 'R6805:Def6'
ID 533558
Institutional Source Beutler Lab
Gene Symbol Def6
Ensembl Gene ENSMUSG00000002257
Gene Name differentially expressed in FDCP 6
Synonyms SLAT, 2410003F05Rik, 6430538D02Rik, IRF-4-binding protein, IBP
MMRRC Submission 044918-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6805 (G1)
Quality Score 158.009
Status Validated
Chromosome 17
Chromosomal Location 28426752-28447582 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 28442691 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 285 (T285A)
Ref Sequence ENSEMBL: ENSMUSP00000002327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002327]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000002327
AA Change: T285A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002327
Gene: ENSMUSG00000002257
AA Change: T285A

DomainStartEndE-ValueType
low complexity region 145 166 N/A INTRINSIC
PH 217 314 3.87e-20 SMART
coiled coil region 318 551 N/A INTRINSIC
Meta Mutation Damage Score 0.3484 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEF6, or IBP, is a guanine nucleotide exchange factor (GEF) for RAC (MIM 602048) and CDC42 (MIM 116952) that is highly expressed in B and T cells (Gupta et al., 2003 [PubMed 12923183]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutants spontaneously develop systemic autoimmunity. Females primarily are affected, displaying hypergammaglobulinemia, accumulation of effector/memory T cells and IgG+ B cells, and production of autoantibodies [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 81,946,744 (GRCm39) T214A possibly damaging Het
A930009A15Rik G T 10: 115,415,810 (GRCm39) probably benign Het
Aadac A C 3: 59,944,757 (GRCm39) D143A probably benign Het
Acot10 T G 15: 20,665,452 (GRCm39) T430P probably benign Het
Adgrb3 T C 1: 25,865,253 (GRCm39) T197A possibly damaging Het
Bbs1 A G 19: 4,950,643 (GRCm39) I200T probably damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Cadps G A 14: 12,467,103 (GRCm38) A943V probably damaging Het
Cc2d2a A G 5: 43,838,673 (GRCm39) E48G probably damaging Het
Clca3a1 A T 3: 144,724,428 (GRCm39) C211S probably damaging Het
Col18a1 A G 10: 76,890,073 (GRCm39) L1429P probably damaging Het
Cplane1 T C 15: 8,273,790 (GRCm39) V2591A probably benign Het
Cul2 T G 18: 3,421,263 (GRCm39) Y196D probably damaging Het
D630023F18Rik T C 1: 65,156,365 (GRCm39) S43G probably benign Het
Ddx39a G A 8: 84,449,766 (GRCm39) R427Q probably damaging Het
Defb21 T A 2: 152,416,789 (GRCm39) D88E probably benign Het
Defb6 A G 8: 19,278,117 (GRCm39) K63R probably benign Het
Dnph1 T C 17: 46,809,670 (GRCm39) S112P probably damaging Het
Dock10 T A 1: 80,564,407 (GRCm39) I467L probably benign Het
Dspp C A 5: 104,323,716 (GRCm39) H286Q probably benign Het
Eya1 T A 1: 14,253,501 (GRCm39) T459S probably benign Het
Faf1 T C 4: 109,719,049 (GRCm39) L385P probably damaging Het
Fbxw21 C A 9: 108,986,633 (GRCm39) R82L probably damaging Het
Fryl A G 5: 73,222,437 (GRCm39) V2048A probably benign Het
Galnt5 A T 2: 57,925,311 (GRCm39) D864V possibly damaging Het
Gata6 T G 18: 11,054,460 (GRCm39) S130A possibly damaging Het
Gbf1 G T 19: 46,250,946 (GRCm39) R434L probably damaging Het
Gga3 A G 11: 115,476,588 (GRCm39) F709L probably damaging Het
Hcar1 A G 5: 124,017,193 (GRCm39) V166A probably benign Het
Hexa T A 9: 59,471,220 (GRCm39) N491K possibly damaging Het
Hpse2 A T 19: 43,282,760 (GRCm39) C164* probably null Het
Ifi202b T C 1: 173,802,555 (GRCm39) Y93C probably damaging Het
Iftap T C 2: 101,396,804 (GRCm39) K192E probably benign Het
Iscu T A 5: 113,913,304 (GRCm39) I79N probably damaging Het
Jmjd7 T A 2: 119,861,804 (GRCm39) Y182* probably null Het
Jup A T 11: 100,274,284 (GRCm39) D135E probably benign Het
Kit T A 5: 75,813,468 (GRCm39) I881N probably damaging Het
Llgl1 T A 11: 60,593,691 (GRCm39) S55T probably benign Het
Lonp2 G A 8: 87,435,724 (GRCm39) M653I probably benign Het
Lrp8 T C 4: 107,711,517 (GRCm39) Y307H probably damaging Het
Med13 A T 11: 86,169,622 (GRCm39) M1914K possibly damaging Het
Ms4a1 A G 19: 11,230,537 (GRCm39) probably null Het
Naip1 A G 13: 100,563,849 (GRCm39) S439P probably benign Het
Nrg1 T C 8: 32,311,292 (GRCm39) R476G probably damaging Het
Or10ag59 T A 2: 87,405,262 (GRCm39) probably null Het
Or7g20 G T 9: 18,946,597 (GRCm39) M59I probably damaging Het
Pds5b T A 5: 150,729,026 (GRCm39) probably null Het
Phf12 G A 11: 77,918,199 (GRCm39) G804R probably damaging Het
Pou6f2 T C 13: 18,414,074 (GRCm39) T234A Het
Prune2 A T 19: 17,097,954 (GRCm39) I1153L probably benign Het
Ptprc C T 1: 137,995,623 (GRCm39) probably null Het
Qpctl T C 7: 18,883,079 (GRCm39) Q11R probably benign Het
Rfx4 A G 10: 84,676,092 (GRCm39) K103E possibly damaging Het
Srcin1 T A 11: 97,442,806 (GRCm39) probably null Het
St6galnac1 G T 11: 116,659,770 (GRCm39) A181D probably damaging Het
Stk36 T C 1: 74,661,398 (GRCm39) V475A probably benign Het
Tbc1d21 T C 9: 58,268,571 (GRCm39) T263A possibly damaging Het
Tex24 A T 8: 27,835,028 (GRCm39) K185N probably damaging Het
Tnxb T A 17: 34,917,127 (GRCm39) V2174E possibly damaging Het
Tollip A G 7: 141,444,582 (GRCm39) S57P probably benign Het
Zbtb49 A G 5: 38,370,585 (GRCm39) probably benign Het
Zfp758 A G 17: 22,580,650 (GRCm39) T30A probably benign Het
Other mutations in Def6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Def6 APN 17 28,438,714 (GRCm39) splice site probably benign
IGL01619:Def6 APN 17 28,426,838 (GRCm39) missense probably damaging 1.00
IGL01737:Def6 APN 17 28,442,701 (GRCm39) missense possibly damaging 0.94
IGL02550:Def6 APN 17 28,447,235 (GRCm39) missense probably benign 0.03
Huntsville UTSW 17 28,438,950 (GRCm39) missense probably damaging 0.99
Redstone UTSW 17 28,436,729 (GRCm39) missense probably damaging 1.00
Silos UTSW 17 28,436,066 (GRCm39) missense probably damaging 1.00
R0013:Def6 UTSW 17 28,436,066 (GRCm39) missense probably damaging 1.00
R0335:Def6 UTSW 17 28,447,043 (GRCm39) missense possibly damaging 0.83
R0357:Def6 UTSW 17 28,442,909 (GRCm39) missense probably damaging 1.00
R0373:Def6 UTSW 17 28,439,154 (GRCm39) missense probably damaging 0.96
R1161:Def6 UTSW 17 28,436,593 (GRCm39) missense probably benign 0.00
R1310:Def6 UTSW 17 28,436,593 (GRCm39) missense probably benign 0.00
R1470:Def6 UTSW 17 28,444,956 (GRCm39) missense possibly damaging 0.67
R1470:Def6 UTSW 17 28,444,956 (GRCm39) missense possibly damaging 0.67
R1636:Def6 UTSW 17 28,442,892 (GRCm39) missense possibly damaging 0.95
R1778:Def6 UTSW 17 28,439,160 (GRCm39) missense probably benign 0.02
R2432:Def6 UTSW 17 28,447,043 (GRCm39) missense probably benign 0.03
R3881:Def6 UTSW 17 28,439,189 (GRCm39) missense probably damaging 1.00
R4402:Def6 UTSW 17 28,438,950 (GRCm39) missense probably damaging 0.99
R4589:Def6 UTSW 17 28,447,121 (GRCm39) missense probably benign
R4683:Def6 UTSW 17 28,436,609 (GRCm39) missense probably damaging 0.99
R5704:Def6 UTSW 17 28,447,200 (GRCm39) missense probably benign
R6481:Def6 UTSW 17 28,445,137 (GRCm39) missense probably benign 0.00
R7029:Def6 UTSW 17 28,444,943 (GRCm39) missense probably benign 0.05
R7863:Def6 UTSW 17 28,446,841 (GRCm39) missense possibly damaging 0.62
R8229:Def6 UTSW 17 28,436,729 (GRCm39) missense probably damaging 1.00
R8856:Def6 UTSW 17 28,435,972 (GRCm39) missense probably damaging 1.00
R9297:Def6 UTSW 17 28,436,714 (GRCm39) missense probably damaging 1.00
R9671:Def6 UTSW 17 28,438,755 (GRCm39) missense probably benign 0.04
R9684:Def6 UTSW 17 28,436,044 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATGCATACTCCTGGCAG -3'
(R):5'- TTTCAGGTCCTTGTGCAGC -3'

Sequencing Primer
(F):5'- ATGCATACTCCTGGCAGGGTAG -3'
(R):5'- ATCGCAGTCTGGATGGCTAAG -3'
Posted On 2018-09-12