Incidental Mutation 'R6805:Tnxb'
ID 533559
Institutional Source Beutler Lab
Gene Symbol Tnxb
Ensembl Gene ENSMUSG00000033327
Gene Name tenascin XB
Synonyms Tnx, TN-MHC
MMRRC Submission 044918-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6805 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 34879431-34938789 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34917127 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 2174 (V2174E)
Ref Sequence ENSEMBL: ENSMUSP00000084661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087399] [ENSMUST00000168533]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000087399
AA Change: V2174E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084661
Gene: ENSMUSG00000033327
AA Change: V2174E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
EGF 173 201 1.59e1 SMART
EGF 204 232 7.41e0 SMART
EGF 235 263 2.64e1 SMART
EGF 266 294 2.64e1 SMART
EGF 297 325 9.13e0 SMART
EGF 328 356 2.07e1 SMART
EGF_like 359 387 3.16e1 SMART
EGF_like 390 418 4.64e1 SMART
EGF_like 421 449 3.29e1 SMART
EGF_like 452 480 7.09e1 SMART
EGF 483 511 1.15e1 SMART
EGF 514 542 1.91e1 SMART
EGF_like 545 573 4.11e1 SMART
EGF 576 604 7.95e0 SMART
EGF 607 635 1.23e1 SMART
EGF_like 638 666 4.93e1 SMART
EGF_like 674 702 5.24e1 SMART
EGF 705 733 2.29e1 SMART
FN3 736 816 4.12e-3 SMART
FN3 827 904 1.21e-9 SMART
FN3 1047 1126 3.97e-5 SMART
FN3 1142 1223 3.62e-8 SMART
low complexity region 1230 1241 N/A INTRINSIC
FN3 1242 1320 2.31e-6 SMART
FN3 1351 1431 8.77e-7 SMART
FN3 1460 1539 3.01e-5 SMART
FN3 1556 1636 2.76e-4 SMART
FN3 1657 1736 5.78e-7 SMART
FN3 1752 1832 4.7e-7 SMART
FN3 1851 1929 1.95e-4 SMART
FN3 1955 2034 4.56e-5 SMART
FN3 2066 2145 2.23e-8 SMART
FN3 2164 2244 7.75e-8 SMART
FN3 2279 2358 8.5e-5 SMART
FN3 2387 2467 2.94e-8 SMART
FN3 2501 2580 1.7e-4 SMART
low complexity region 2588 2598 N/A INTRINSIC
FN3 2607 2687 6.75e-8 SMART
FN3 2716 2795 7.4e-5 SMART
FN3 2822 2902 1.35e-7 SMART
FN3 2931 3010 5.61e-5 SMART
FN3 3026 3106 6.01e-5 SMART
FN3 3120 3199 6.45e-5 SMART
FN3 3214 3293 9.54e-8 SMART
FN3 3316 3396 2.81e-5 SMART
FN3 3416 3502 1.98e-5 SMART
FN3 3518 3596 5.65e-10 SMART
FN3 3607 3682 7.63e-7 SMART
FN3 3695 3770 6.54e-6 SMART
FBG 3787 3997 8.88e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168533
SMART Domains Protein: ENSMUSP00000127487
Gene: ENSMUSG00000033327

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
EGF 173 201 1.59e1 SMART
EGF 204 232 7.41e0 SMART
EGF 235 263 2.64e1 SMART
EGF 266 294 2.64e1 SMART
EGF 297 325 9.13e0 SMART
EGF 328 356 2.07e1 SMART
EGF_like 359 387 3.16e1 SMART
EGF_like 390 418 4.64e1 SMART
EGF_like 421 449 3.29e1 SMART
EGF_like 452 480 7.09e1 SMART
EGF 483 511 1.15e1 SMART
EGF 514 542 1.91e1 SMART
EGF_like 545 573 4.11e1 SMART
EGF 576 604 7.95e0 SMART
EGF 607 635 1.23e1 SMART
EGF_like 638 666 4.93e1 SMART
EGF_like 674 702 5.24e1 SMART
EGF 705 733 2.29e1 SMART
FN3 736 816 4.12e-3 SMART
FN3 827 904 1.21e-9 SMART
FN3 924 1003 3.97e-5 SMART
FN3 1019 1100 3.62e-8 SMART
low complexity region 1107 1118 N/A INTRINSIC
FN3 1119 1197 2.31e-6 SMART
FN3 1228 1308 8.77e-7 SMART
FN3 1337 1416 3.01e-5 SMART
FN3 1433 1513 2.76e-4 SMART
FN3 1534 1613 5.78e-7 SMART
FN3 1629 1709 4.7e-7 SMART
FN3 1728 1806 1.95e-4 SMART
FN3 1832 1911 4.56e-5 SMART
FN3 1943 2022 2.23e-8 SMART
FN3 2051 2130 5.61e-5 SMART
FN3 2146 2226 6.01e-5 SMART
FN3 2240 2319 6.45e-5 SMART
FN3 2334 2413 9.54e-8 SMART
FN3 2436 2516 2.81e-5 SMART
FN3 2536 2622 1.98e-5 SMART
FN3 2638 2716 5.65e-10 SMART
FN3 2727 2802 7.63e-7 SMART
FN3 2815 2890 6.54e-6 SMART
FBG 2907 3117 8.88e-125 SMART
Meta Mutation Damage Score 0.0756 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The tenascins have anti-adhesive effects, as opposed to fibronectin which is adhesive. This protein is thought to function in matrix maturation during wound healing, and its deficiency has been associated with the connective tissue disorder Ehlers-Danlos syndrome. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. It is one of four genes in this cluster which have been duplicated. The duplicated copy of this gene is incomplete and is a pseudogene which is transcribed but does not encode a protein. The structure of this gene is unusual in that it overlaps the CREBL1 and CYP21A2 genes at its 5' and 3' ends, respectively. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have stretchy skin, similar to patients with human Ehlers-Danlos syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 81,946,744 (GRCm39) T214A possibly damaging Het
A930009A15Rik G T 10: 115,415,810 (GRCm39) probably benign Het
Aadac A C 3: 59,944,757 (GRCm39) D143A probably benign Het
Acot10 T G 15: 20,665,452 (GRCm39) T430P probably benign Het
Adgrb3 T C 1: 25,865,253 (GRCm39) T197A possibly damaging Het
Bbs1 A G 19: 4,950,643 (GRCm39) I200T probably damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Cadps G A 14: 12,467,103 (GRCm38) A943V probably damaging Het
Cc2d2a A G 5: 43,838,673 (GRCm39) E48G probably damaging Het
Clca3a1 A T 3: 144,724,428 (GRCm39) C211S probably damaging Het
Col18a1 A G 10: 76,890,073 (GRCm39) L1429P probably damaging Het
Cplane1 T C 15: 8,273,790 (GRCm39) V2591A probably benign Het
Cul2 T G 18: 3,421,263 (GRCm39) Y196D probably damaging Het
D630023F18Rik T C 1: 65,156,365 (GRCm39) S43G probably benign Het
Ddx39a G A 8: 84,449,766 (GRCm39) R427Q probably damaging Het
Def6 A G 17: 28,442,691 (GRCm39) T285A probably damaging Het
Defb21 T A 2: 152,416,789 (GRCm39) D88E probably benign Het
Defb6 A G 8: 19,278,117 (GRCm39) K63R probably benign Het
Dnph1 T C 17: 46,809,670 (GRCm39) S112P probably damaging Het
Dock10 T A 1: 80,564,407 (GRCm39) I467L probably benign Het
Dspp C A 5: 104,323,716 (GRCm39) H286Q probably benign Het
Eya1 T A 1: 14,253,501 (GRCm39) T459S probably benign Het
Faf1 T C 4: 109,719,049 (GRCm39) L385P probably damaging Het
Fbxw21 C A 9: 108,986,633 (GRCm39) R82L probably damaging Het
Fryl A G 5: 73,222,437 (GRCm39) V2048A probably benign Het
Galnt5 A T 2: 57,925,311 (GRCm39) D864V possibly damaging Het
Gata6 T G 18: 11,054,460 (GRCm39) S130A possibly damaging Het
Gbf1 G T 19: 46,250,946 (GRCm39) R434L probably damaging Het
Gga3 A G 11: 115,476,588 (GRCm39) F709L probably damaging Het
Hcar1 A G 5: 124,017,193 (GRCm39) V166A probably benign Het
Hexa T A 9: 59,471,220 (GRCm39) N491K possibly damaging Het
Hpse2 A T 19: 43,282,760 (GRCm39) C164* probably null Het
Ifi202b T C 1: 173,802,555 (GRCm39) Y93C probably damaging Het
Iftap T C 2: 101,396,804 (GRCm39) K192E probably benign Het
Iscu T A 5: 113,913,304 (GRCm39) I79N probably damaging Het
Jmjd7 T A 2: 119,861,804 (GRCm39) Y182* probably null Het
Jup A T 11: 100,274,284 (GRCm39) D135E probably benign Het
Kit T A 5: 75,813,468 (GRCm39) I881N probably damaging Het
Llgl1 T A 11: 60,593,691 (GRCm39) S55T probably benign Het
Lonp2 G A 8: 87,435,724 (GRCm39) M653I probably benign Het
Lrp8 T C 4: 107,711,517 (GRCm39) Y307H probably damaging Het
Med13 A T 11: 86,169,622 (GRCm39) M1914K possibly damaging Het
Ms4a1 A G 19: 11,230,537 (GRCm39) probably null Het
Naip1 A G 13: 100,563,849 (GRCm39) S439P probably benign Het
Nrg1 T C 8: 32,311,292 (GRCm39) R476G probably damaging Het
Or10ag59 T A 2: 87,405,262 (GRCm39) probably null Het
Or7g20 G T 9: 18,946,597 (GRCm39) M59I probably damaging Het
Pds5b T A 5: 150,729,026 (GRCm39) probably null Het
Phf12 G A 11: 77,918,199 (GRCm39) G804R probably damaging Het
Pou6f2 T C 13: 18,414,074 (GRCm39) T234A Het
Prune2 A T 19: 17,097,954 (GRCm39) I1153L probably benign Het
Ptprc C T 1: 137,995,623 (GRCm39) probably null Het
Qpctl T C 7: 18,883,079 (GRCm39) Q11R probably benign Het
Rfx4 A G 10: 84,676,092 (GRCm39) K103E possibly damaging Het
Srcin1 T A 11: 97,442,806 (GRCm39) probably null Het
St6galnac1 G T 11: 116,659,770 (GRCm39) A181D probably damaging Het
Stk36 T C 1: 74,661,398 (GRCm39) V475A probably benign Het
Tbc1d21 T C 9: 58,268,571 (GRCm39) T263A possibly damaging Het
Tex24 A T 8: 27,835,028 (GRCm39) K185N probably damaging Het
Tollip A G 7: 141,444,582 (GRCm39) S57P probably benign Het
Zbtb49 A G 5: 38,370,585 (GRCm39) probably benign Het
Zfp758 A G 17: 22,580,650 (GRCm39) T30A probably benign Het
Other mutations in Tnxb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Tnxb APN 17 34,904,603 (GRCm39) missense probably damaging 1.00
IGL00424:Tnxb APN 17 34,933,666 (GRCm39) missense probably damaging 1.00
IGL00486:Tnxb APN 17 34,911,356 (GRCm39) missense probably damaging 1.00
IGL00952:Tnxb APN 17 34,932,102 (GRCm39) missense probably damaging 1.00
IGL00974:Tnxb APN 17 34,937,707 (GRCm39) critical splice donor site probably null
IGL01017:Tnxb APN 17 34,912,782 (GRCm39) missense probably damaging 0.98
IGL01082:Tnxb APN 17 34,933,584 (GRCm39) missense probably damaging 0.97
IGL01397:Tnxb APN 17 34,933,647 (GRCm39) missense probably damaging 0.99
IGL01473:Tnxb APN 17 34,904,675 (GRCm39) missense probably damaging 0.99
IGL01642:Tnxb APN 17 34,937,488 (GRCm39) missense probably damaging 1.00
IGL01774:Tnxb APN 17 34,907,813 (GRCm39) missense probably damaging 1.00
IGL01971:Tnxb APN 17 34,891,271 (GRCm39) missense probably damaging 1.00
IGL02016:Tnxb APN 17 34,891,249 (GRCm39) missense probably damaging 0.98
IGL02160:Tnxb APN 17 34,933,719 (GRCm39) missense probably benign 0.01
IGL02473:Tnxb APN 17 34,936,736 (GRCm39) missense probably damaging 1.00
IGL02666:Tnxb APN 17 34,903,913 (GRCm39) missense probably benign 0.20
IGL02831:Tnxb APN 17 34,922,545 (GRCm39) missense possibly damaging 0.93
IGL02838:Tnxb APN 17 34,908,606 (GRCm39) missense possibly damaging 0.74
IGL02965:Tnxb APN 17 34,928,628 (GRCm39) missense possibly damaging 0.93
IGL03155:Tnxb APN 17 34,932,569 (GRCm39) missense probably damaging 1.00
IGL03194:Tnxb APN 17 34,914,921 (GRCm39) nonsense probably null
IGL03215:Tnxb APN 17 34,911,499 (GRCm39) missense possibly damaging 0.66
IGL03256:Tnxb APN 17 34,907,694 (GRCm39) missense probably damaging 1.00
BB008:Tnxb UTSW 17 34,907,672 (GRCm39) missense probably damaging 1.00
BB018:Tnxb UTSW 17 34,907,672 (GRCm39) missense probably damaging 1.00
E0370:Tnxb UTSW 17 34,897,917 (GRCm39) missense probably damaging 1.00
R0006:Tnxb UTSW 17 34,901,266 (GRCm39) missense probably benign 0.07
R0049:Tnxb UTSW 17 34,928,542 (GRCm39) missense possibly damaging 0.93
R0050:Tnxb UTSW 17 34,892,299 (GRCm39) missense probably damaging 1.00
R0233:Tnxb UTSW 17 34,918,007 (GRCm39) missense probably benign 0.32
R0233:Tnxb UTSW 17 34,918,007 (GRCm39) missense probably benign 0.32
R0311:Tnxb UTSW 17 34,935,958 (GRCm39) missense probably damaging 0.97
R0326:Tnxb UTSW 17 34,917,153 (GRCm39) missense probably benign 0.32
R0387:Tnxb UTSW 17 34,902,548 (GRCm39) missense probably benign 0.30
R0396:Tnxb UTSW 17 34,890,707 (GRCm39) missense probably damaging 1.00
R0511:Tnxb UTSW 17 34,937,219 (GRCm39) missense probably damaging 0.96
R0540:Tnxb UTSW 17 34,890,892 (GRCm39) missense probably damaging 1.00
R0563:Tnxb UTSW 17 34,935,921 (GRCm39) missense probably benign 0.05
R0575:Tnxb UTSW 17 34,936,180 (GRCm39) missense possibly damaging 0.91
R0586:Tnxb UTSW 17 34,891,118 (GRCm39) missense probably damaging 1.00
R0607:Tnxb UTSW 17 34,890,892 (GRCm39) missense probably damaging 1.00
R0622:Tnxb UTSW 17 34,937,703 (GRCm39) missense probably damaging 1.00
R0624:Tnxb UTSW 17 34,902,522 (GRCm39) missense probably damaging 1.00
R0709:Tnxb UTSW 17 34,908,328 (GRCm39) missense probably damaging 1.00
R0898:Tnxb UTSW 17 34,889,719 (GRCm39) missense probably damaging 1.00
R0970:Tnxb UTSW 17 34,917,917 (GRCm39) missense possibly damaging 0.85
R0972:Tnxb UTSW 17 34,904,117 (GRCm39) missense probably damaging 1.00
R1118:Tnxb UTSW 17 34,904,017 (GRCm39) missense probably damaging 1.00
R1119:Tnxb UTSW 17 34,904,017 (GRCm39) missense probably damaging 1.00
R1226:Tnxb UTSW 17 34,907,903 (GRCm39) missense probably damaging 1.00
R1296:Tnxb UTSW 17 34,890,551 (GRCm39) missense probably damaging 1.00
R1297:Tnxb UTSW 17 34,929,140 (GRCm39) missense probably damaging 0.96
R1349:Tnxb UTSW 17 34,929,267 (GRCm39) missense possibly damaging 0.67
R1356:Tnxb UTSW 17 34,914,446 (GRCm39) missense possibly damaging 0.53
R1372:Tnxb UTSW 17 34,929,267 (GRCm39) missense possibly damaging 0.67
R1521:Tnxb UTSW 17 34,930,477 (GRCm39) missense probably damaging 1.00
R1522:Tnxb UTSW 17 34,937,612 (GRCm39) missense probably damaging 1.00
R1532:Tnxb UTSW 17 34,929,804 (GRCm39) missense probably damaging 1.00
R1735:Tnxb UTSW 17 34,936,944 (GRCm39) missense probably damaging 1.00
R1778:Tnxb UTSW 17 34,902,548 (GRCm39) missense probably benign 0.30
R1802:Tnxb UTSW 17 34,922,863 (GRCm39) missense probably damaging 0.98
R1824:Tnxb UTSW 17 34,911,307 (GRCm39) nonsense probably null
R1838:Tnxb UTSW 17 34,897,884 (GRCm39) missense probably damaging 0.96
R1863:Tnxb UTSW 17 34,889,848 (GRCm39) missense probably damaging 1.00
R1865:Tnxb UTSW 17 34,922,431 (GRCm39) nonsense probably null
R1867:Tnxb UTSW 17 34,890,821 (GRCm39) missense probably damaging 1.00
R1883:Tnxb UTSW 17 34,908,539 (GRCm39) missense probably benign 0.01
R1884:Tnxb UTSW 17 34,908,539 (GRCm39) missense probably benign 0.01
R1889:Tnxb UTSW 17 34,914,799 (GRCm39) missense probably damaging 0.97
R1969:Tnxb UTSW 17 34,898,055 (GRCm39) missense probably benign 0.20
R1989:Tnxb UTSW 17 34,912,859 (GRCm39) missense probably damaging 1.00
R1989:Tnxb UTSW 17 34,902,351 (GRCm39) missense probably benign 0.08
R1991:Tnxb UTSW 17 34,901,225 (GRCm39) missense probably damaging 1.00
R1991:Tnxb UTSW 17 34,890,878 (GRCm39) missense probably damaging 1.00
R1992:Tnxb UTSW 17 34,890,878 (GRCm39) missense probably damaging 1.00
R2001:Tnxb UTSW 17 34,911,553 (GRCm39) missense possibly damaging 0.82
R2018:Tnxb UTSW 17 34,890,724 (GRCm39) missense probably benign 0.04
R2030:Tnxb UTSW 17 34,937,443 (GRCm39) missense probably damaging 1.00
R2037:Tnxb UTSW 17 34,918,179 (GRCm39) missense probably damaging 1.00
R2103:Tnxb UTSW 17 34,901,225 (GRCm39) missense probably damaging 1.00
R2116:Tnxb UTSW 17 34,891,201 (GRCm39) missense probably damaging 1.00
R2206:Tnxb UTSW 17 34,928,391 (GRCm39) missense possibly damaging 0.86
R2207:Tnxb UTSW 17 34,928,391 (GRCm39) missense possibly damaging 0.86
R2215:Tnxb UTSW 17 34,923,114 (GRCm39) missense possibly damaging 0.93
R2413:Tnxb UTSW 17 34,937,252 (GRCm39) missense probably damaging 0.99
R2680:Tnxb UTSW 17 34,922,594 (GRCm39) missense possibly damaging 0.51
R2910:Tnxb UTSW 17 34,891,424 (GRCm39) missense probably damaging 1.00
R2984:Tnxb UTSW 17 34,897,636 (GRCm39) nonsense probably null
R3120:Tnxb UTSW 17 34,911,329 (GRCm39) missense possibly damaging 0.86
R3429:Tnxb UTSW 17 34,922,561 (GRCm39) missense probably damaging 0.98
R3429:Tnxb UTSW 17 34,891,605 (GRCm39) nonsense probably null
R3552:Tnxb UTSW 17 34,937,695 (GRCm39) missense probably damaging 1.00
R3698:Tnxb UTSW 17 34,909,407 (GRCm39) critical splice donor site probably null
R3720:Tnxb UTSW 17 34,931,938 (GRCm39) missense possibly damaging 0.95
R3841:Tnxb UTSW 17 34,917,897 (GRCm39) missense possibly damaging 0.72
R3848:Tnxb UTSW 17 34,909,369 (GRCm39) missense possibly damaging 0.82
R3886:Tnxb UTSW 17 34,937,885 (GRCm39) missense probably damaging 1.00
R4074:Tnxb UTSW 17 34,890,845 (GRCm39) missense probably benign 0.22
R4159:Tnxb UTSW 17 34,930,491 (GRCm39) missense probably damaging 0.99
R4160:Tnxb UTSW 17 34,930,491 (GRCm39) missense probably damaging 0.99
R4161:Tnxb UTSW 17 34,930,491 (GRCm39) missense probably damaging 0.99
R4181:Tnxb UTSW 17 34,928,428 (GRCm39) missense possibly damaging 0.93
R4210:Tnxb UTSW 17 34,929,951 (GRCm39) missense possibly damaging 0.84
R4275:Tnxb UTSW 17 34,917,205 (GRCm39) missense probably damaging 0.98
R4329:Tnxb UTSW 17 34,912,838 (GRCm39) missense probably damaging 1.00
R4394:Tnxb UTSW 17 34,897,636 (GRCm39) nonsense probably null
R4395:Tnxb UTSW 17 34,897,636 (GRCm39) nonsense probably null
R4397:Tnxb UTSW 17 34,897,636 (GRCm39) nonsense probably null
R4540:Tnxb UTSW 17 34,922,309 (GRCm39) missense possibly damaging 0.86
R4673:Tnxb UTSW 17 34,891,514 (GRCm39) missense probably damaging 0.99
R4719:Tnxb UTSW 17 34,908,394 (GRCm39) missense probably damaging 1.00
R4725:Tnxb UTSW 17 34,918,041 (GRCm39) missense probably damaging 0.99
R4753:Tnxb UTSW 17 34,914,909 (GRCm39) missense possibly damaging 0.71
R4777:Tnxb UTSW 17 34,890,917 (GRCm39) missense probably damaging 1.00
R4837:Tnxb UTSW 17 34,936,981 (GRCm39) missense probably damaging 0.98
R4898:Tnxb UTSW 17 34,914,566 (GRCm39) missense possibly damaging 0.95
R4938:Tnxb UTSW 17 34,932,606 (GRCm39) missense probably damaging 1.00
R5044:Tnxb UTSW 17 34,936,457 (GRCm39) missense probably damaging 1.00
R5100:Tnxb UTSW 17 34,929,902 (GRCm39) missense probably damaging 0.99
R5223:Tnxb UTSW 17 34,923,052 (GRCm39) missense possibly damaging 0.51
R5269:Tnxb UTSW 17 34,922,582 (GRCm39) missense possibly damaging 0.95
R5333:Tnxb UTSW 17 34,909,205 (GRCm39) missense probably damaging 1.00
R5454:Tnxb UTSW 17 34,928,599 (GRCm39) missense possibly damaging 0.71
R5470:Tnxb UTSW 17 34,935,947 (GRCm39) missense probably null 1.00
R5475:Tnxb UTSW 17 34,908,567 (GRCm39) missense probably damaging 1.00
R5574:Tnxb UTSW 17 34,929,998 (GRCm39) missense probably benign
R5596:Tnxb UTSW 17 34,907,778 (GRCm39) missense probably damaging 1.00
R5599:Tnxb UTSW 17 34,909,179 (GRCm39) missense probably benign 0.22
R5599:Tnxb UTSW 17 34,909,176 (GRCm39) missense probably damaging 1.00
R5615:Tnxb UTSW 17 34,902,392 (GRCm39) missense probably damaging 1.00
R5620:Tnxb UTSW 17 34,936,504 (GRCm39) nonsense probably null
R5625:Tnxb UTSW 17 34,904,185 (GRCm39) missense probably benign 0.30
R5734:Tnxb UTSW 17 34,917,884 (GRCm39) missense possibly damaging 0.53
R5896:Tnxb UTSW 17 34,891,126 (GRCm39) missense probably damaging 1.00
R5961:Tnxb UTSW 17 34,937,609 (GRCm39) missense probably damaging 1.00
R5974:Tnxb UTSW 17 34,904,681 (GRCm39) missense probably damaging 1.00
R6091:Tnxb UTSW 17 34,929,338 (GRCm39) missense probably damaging 0.98
R6134:Tnxb UTSW 17 34,890,986 (GRCm39) missense probably damaging 0.96
R6325:Tnxb UTSW 17 34,911,398 (GRCm39) missense probably damaging 1.00
R6358:Tnxb UTSW 17 34,897,968 (GRCm39) missense probably damaging 0.98
R6362:Tnxb UTSW 17 34,913,362 (GRCm39) missense probably damaging 1.00
R6432:Tnxb UTSW 17 34,936,891 (GRCm39) missense probably damaging 1.00
R6461:Tnxb UTSW 17 34,890,872 (GRCm39) missense probably damaging 1.00
R6467:Tnxb UTSW 17 34,912,898 (GRCm39) missense probably damaging 1.00
R6476:Tnxb UTSW 17 34,909,166 (GRCm39) missense probably damaging 0.98
R6477:Tnxb UTSW 17 34,938,513 (GRCm39) missense probably damaging 1.00
R6631:Tnxb UTSW 17 34,937,222 (GRCm39) missense probably damaging 1.00
R6774:Tnxb UTSW 17 34,928,606 (GRCm39) nonsense probably null
R6787:Tnxb UTSW 17 34,929,710 (GRCm39) missense probably benign 0.02
R6860:Tnxb UTSW 17 34,932,131 (GRCm39) missense probably damaging 0.99
R6883:Tnxb UTSW 17 34,937,493 (GRCm39) missense probably damaging 1.00
R7049:Tnxb UTSW 17 34,936,242 (GRCm39) critical splice donor site probably null
R7107:Tnxb UTSW 17 34,890,314 (GRCm39) missense unknown
R7172:Tnxb UTSW 17 34,914,994 (GRCm39) missense probably damaging 1.00
R7206:Tnxb UTSW 17 34,923,075 (GRCm39) missense possibly damaging 0.71
R7219:Tnxb UTSW 17 34,898,039 (GRCm39) missense probably benign 0.08
R7237:Tnxb UTSW 17 34,901,170 (GRCm39) missense possibly damaging 0.82
R7257:Tnxb UTSW 17 34,935,475 (GRCm39) missense probably benign 0.44
R7269:Tnxb UTSW 17 34,914,428 (GRCm39) missense probably damaging 1.00
R7302:Tnxb UTSW 17 34,897,875 (GRCm39) missense probably benign 0.41
R7372:Tnxb UTSW 17 34,936,228 (GRCm39) missense possibly damaging 0.72
R7384:Tnxb UTSW 17 34,937,492 (GRCm39) missense probably damaging 1.00
R7447:Tnxb UTSW 17 34,937,444 (GRCm39) missense probably damaging 1.00
R7449:Tnxb UTSW 17 34,922,335 (GRCm39) missense possibly damaging 0.93
R7480:Tnxb UTSW 17 34,934,747 (GRCm39) missense probably damaging 0.96
R7506:Tnxb UTSW 17 34,934,665 (GRCm39) missense possibly damaging 0.89
R7586:Tnxb UTSW 17 34,935,382 (GRCm39) missense probably damaging 0.98
R7688:Tnxb UTSW 17 34,890,880 (GRCm39) missense probably benign 0.23
R7690:Tnxb UTSW 17 34,908,501 (GRCm39) missense probably damaging 1.00
R7690:Tnxb UTSW 17 34,908,494 (GRCm39) missense probably benign 0.03
R7732:Tnxb UTSW 17 34,913,254 (GRCm39) missense probably damaging 1.00
R7735:Tnxb UTSW 17 34,890,398 (GRCm39) missense unknown
R7760:Tnxb UTSW 17 34,931,911 (GRCm39) missense probably damaging 0.96
R7874:Tnxb UTSW 17 34,930,417 (GRCm39) missense probably damaging 1.00
R7909:Tnxb UTSW 17 34,911,428 (GRCm39) missense probably benign 0.02
R7922:Tnxb UTSW 17 34,933,577 (GRCm39) missense probably damaging 1.00
R7931:Tnxb UTSW 17 34,907,672 (GRCm39) missense probably damaging 1.00
R7949:Tnxb UTSW 17 34,936,103 (GRCm39) missense probably damaging 1.00
R7953:Tnxb UTSW 17 34,929,077 (GRCm39) missense probably benign 0.03
R7953:Tnxb UTSW 17 34,928,509 (GRCm39) missense possibly damaging 0.86
R7977:Tnxb UTSW 17 34,929,194 (GRCm39) missense possibly damaging 0.92
R7985:Tnxb UTSW 17 34,935,984 (GRCm39) critical splice donor site probably null
R7987:Tnxb UTSW 17 34,929,194 (GRCm39) missense possibly damaging 0.92
R8040:Tnxb UTSW 17 34,935,532 (GRCm39) missense probably damaging 1.00
R8053:Tnxb UTSW 17 34,923,153 (GRCm39) missense probably damaging 0.98
R8074:Tnxb UTSW 17 34,922,955 (GRCm39) missense probably benign 0.32
R8089:Tnxb UTSW 17 34,891,763 (GRCm39) missense unknown
R8169:Tnxb UTSW 17 34,918,181 (GRCm39) missense possibly damaging 0.96
R8348:Tnxb UTSW 17 34,929,102 (GRCm39) missense possibly damaging 0.92
R8352:Tnxb UTSW 17 34,908,381 (GRCm39) missense probably damaging 1.00
R8362:Tnxb UTSW 17 34,931,946 (GRCm39) missense probably damaging 0.99
R8452:Tnxb UTSW 17 34,908,381 (GRCm39) missense probably damaging 1.00
R8527:Tnxb UTSW 17 34,907,634 (GRCm39) missense probably damaging 1.00
R8754:Tnxb UTSW 17 34,934,882 (GRCm39) missense probably damaging 1.00
R8813:Tnxb UTSW 17 34,938,136 (GRCm39) missense probably damaging 1.00
R8936:Tnxb UTSW 17 34,904,646 (GRCm39) missense probably damaging 1.00
R8986:Tnxb UTSW 17 34,897,646 (GRCm39) missense possibly damaging 0.66
R9001:Tnxb UTSW 17 34,922,410 (GRCm39) missense probably benign 0.32
R9215:Tnxb UTSW 17 34,891,564 (GRCm39) missense unknown
R9226:Tnxb UTSW 17 34,904,766 (GRCm39) missense probably damaging 1.00
R9276:Tnxb UTSW 17 34,929,134 (GRCm39) missense possibly damaging 0.60
R9279:Tnxb UTSW 17 34,898,088 (GRCm39) missense possibly damaging 0.46
R9363:Tnxb UTSW 17 34,917,294 (GRCm39) missense possibly damaging 0.93
R9367:Tnxb UTSW 17 34,931,993 (GRCm39) missense probably damaging 1.00
R9494:Tnxb UTSW 17 34,904,796 (GRCm39) missense probably damaging 1.00
R9606:Tnxb UTSW 17 34,914,578 (GRCm39) missense possibly damaging 0.82
R9650:Tnxb UTSW 17 34,930,629 (GRCm39) missense probably damaging 0.99
R9677:Tnxb UTSW 17 34,917,878 (GRCm39) missense possibly damaging 0.93
R9690:Tnxb UTSW 17 34,936,171 (GRCm39) missense probably damaging 1.00
R9761:Tnxb UTSW 17 34,903,987 (GRCm39) missense probably benign 0.32
X0004:Tnxb UTSW 17 34,922,389 (GRCm39) missense possibly damaging 0.71
X0010:Tnxb UTSW 17 34,890,908 (GRCm39) missense probably damaging 1.00
X0019:Tnxb UTSW 17 34,913,163 (GRCm39) missense possibly damaging 0.51
X0063:Tnxb UTSW 17 34,922,482 (GRCm39) missense probably damaging 0.98
X0064:Tnxb UTSW 17 34,913,006 (GRCm39) missense probably damaging 1.00
Z1177:Tnxb UTSW 17 34,937,700 (GRCm39) missense probably damaging 0.99
Z1177:Tnxb UTSW 17 34,902,305 (GRCm39) missense probably damaging 1.00
Z1177:Tnxb UTSW 17 34,890,740 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ACCTGACCTGTCTGATTTCCAAAG -3'
(R):5'- TACTTGTGGTCTGGCTCCAG -3'

Sequencing Primer
(F):5'- CTGTCTGATTTCCAAAGAAGACCGTG -3'
(R):5'- TCCAGGCCTGAGATGGTGAC -3'
Posted On 2018-09-12