Incidental Mutation 'R6805:Cul2'
ID 533561
Institutional Source Beutler Lab
Gene Symbol Cul2
Ensembl Gene ENSMUSG00000024231
Gene Name cullin 2
Synonyms 4932411N15Rik, 1300003D18Rik
MMRRC Submission 044918-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.941) question?
Stock # R6805 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 3382988-3436377 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 3421263 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 196 (Y196D)
Ref Sequence ENSEMBL: ENSMUSP00000123903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025073] [ENSMUST00000080089] [ENSMUST00000161317] [ENSMUST00000162301]
AlphaFold Q9D4H8
Predicted Effect probably damaging
Transcript: ENSMUST00000025073
AA Change: Y259D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025073
Gene: ENSMUSG00000024231
AA Change: Y259D

DomainStartEndE-ValueType
SCOP:d1ldja2 11 386 1e-109 SMART
CULLIN 416 568 1.19e-84 SMART
low complexity region 636 646 N/A INTRINSIC
Pfam:Cullin_Nedd8 651 700 9.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080089
SMART Domains Protein: ENSMUSP00000078988
Gene: ENSMUSG00000024231

DomainStartEndE-ValueType
Pfam:Cullin 14 88 2.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161317
AA Change: Y196D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123903
Gene: ENSMUSG00000024231
AA Change: Y196D

DomainStartEndE-ValueType
CULLIN 353 505 1.19e-84 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162301
AA Change: Y259D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125403
Gene: ENSMUSG00000024231
AA Change: Y259D

DomainStartEndE-ValueType
SCOP:d1ldja2 11 386 1e-108 SMART
CULLIN 416 568 1.19e-84 SMART
low complexity region 636 646 N/A INTRINSIC
Cullin_Nedd8 672 739 1.01e-33 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 81,946,744 (GRCm39) T214A possibly damaging Het
A930009A15Rik G T 10: 115,415,810 (GRCm39) probably benign Het
Aadac A C 3: 59,944,757 (GRCm39) D143A probably benign Het
Acot10 T G 15: 20,665,452 (GRCm39) T430P probably benign Het
Adgrb3 T C 1: 25,865,253 (GRCm39) T197A possibly damaging Het
Bbs1 A G 19: 4,950,643 (GRCm39) I200T probably damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Cadps G A 14: 12,467,103 (GRCm38) A943V probably damaging Het
Cc2d2a A G 5: 43,838,673 (GRCm39) E48G probably damaging Het
Clca3a1 A T 3: 144,724,428 (GRCm39) C211S probably damaging Het
Col18a1 A G 10: 76,890,073 (GRCm39) L1429P probably damaging Het
Cplane1 T C 15: 8,273,790 (GRCm39) V2591A probably benign Het
D630023F18Rik T C 1: 65,156,365 (GRCm39) S43G probably benign Het
Ddx39a G A 8: 84,449,766 (GRCm39) R427Q probably damaging Het
Def6 A G 17: 28,442,691 (GRCm39) T285A probably damaging Het
Defb21 T A 2: 152,416,789 (GRCm39) D88E probably benign Het
Defb6 A G 8: 19,278,117 (GRCm39) K63R probably benign Het
Dnph1 T C 17: 46,809,670 (GRCm39) S112P probably damaging Het
Dock10 T A 1: 80,564,407 (GRCm39) I467L probably benign Het
Dspp C A 5: 104,323,716 (GRCm39) H286Q probably benign Het
Eya1 T A 1: 14,253,501 (GRCm39) T459S probably benign Het
Faf1 T C 4: 109,719,049 (GRCm39) L385P probably damaging Het
Fbxw21 C A 9: 108,986,633 (GRCm39) R82L probably damaging Het
Fryl A G 5: 73,222,437 (GRCm39) V2048A probably benign Het
Galnt5 A T 2: 57,925,311 (GRCm39) D864V possibly damaging Het
Gata6 T G 18: 11,054,460 (GRCm39) S130A possibly damaging Het
Gbf1 G T 19: 46,250,946 (GRCm39) R434L probably damaging Het
Gga3 A G 11: 115,476,588 (GRCm39) F709L probably damaging Het
Hcar1 A G 5: 124,017,193 (GRCm39) V166A probably benign Het
Hexa T A 9: 59,471,220 (GRCm39) N491K possibly damaging Het
Hpse2 A T 19: 43,282,760 (GRCm39) C164* probably null Het
Ifi202b T C 1: 173,802,555 (GRCm39) Y93C probably damaging Het
Iftap T C 2: 101,396,804 (GRCm39) K192E probably benign Het
Iscu T A 5: 113,913,304 (GRCm39) I79N probably damaging Het
Jmjd7 T A 2: 119,861,804 (GRCm39) Y182* probably null Het
Jup A T 11: 100,274,284 (GRCm39) D135E probably benign Het
Kit T A 5: 75,813,468 (GRCm39) I881N probably damaging Het
Llgl1 T A 11: 60,593,691 (GRCm39) S55T probably benign Het
Lonp2 G A 8: 87,435,724 (GRCm39) M653I probably benign Het
Lrp8 T C 4: 107,711,517 (GRCm39) Y307H probably damaging Het
Med13 A T 11: 86,169,622 (GRCm39) M1914K possibly damaging Het
Ms4a1 A G 19: 11,230,537 (GRCm39) probably null Het
Naip1 A G 13: 100,563,849 (GRCm39) S439P probably benign Het
Nrg1 T C 8: 32,311,292 (GRCm39) R476G probably damaging Het
Or10ag59 T A 2: 87,405,262 (GRCm39) probably null Het
Or7g20 G T 9: 18,946,597 (GRCm39) M59I probably damaging Het
Pds5b T A 5: 150,729,026 (GRCm39) probably null Het
Phf12 G A 11: 77,918,199 (GRCm39) G804R probably damaging Het
Pou6f2 T C 13: 18,414,074 (GRCm39) T234A Het
Prune2 A T 19: 17,097,954 (GRCm39) I1153L probably benign Het
Ptprc C T 1: 137,995,623 (GRCm39) probably null Het
Qpctl T C 7: 18,883,079 (GRCm39) Q11R probably benign Het
Rfx4 A G 10: 84,676,092 (GRCm39) K103E possibly damaging Het
Srcin1 T A 11: 97,442,806 (GRCm39) probably null Het
St6galnac1 G T 11: 116,659,770 (GRCm39) A181D probably damaging Het
Stk36 T C 1: 74,661,398 (GRCm39) V475A probably benign Het
Tbc1d21 T C 9: 58,268,571 (GRCm39) T263A possibly damaging Het
Tex24 A T 8: 27,835,028 (GRCm39) K185N probably damaging Het
Tnxb T A 17: 34,917,127 (GRCm39) V2174E possibly damaging Het
Tollip A G 7: 141,444,582 (GRCm39) S57P probably benign Het
Zbtb49 A G 5: 38,370,585 (GRCm39) probably benign Het
Zfp758 A G 17: 22,580,650 (GRCm39) T30A probably benign Het
Other mutations in Cul2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Cul2 APN 18 3,423,487 (GRCm39) missense probably benign
IGL01293:Cul2 APN 18 3,419,426 (GRCm39) missense probably damaging 0.99
IGL02719:Cul2 APN 18 3,434,052 (GRCm39) missense probably damaging 1.00
IGL02886:Cul2 APN 18 3,426,920 (GRCm39) splice site probably benign
IGL03190:Cul2 APN 18 3,429,634 (GRCm39) missense possibly damaging 0.95
IGL03389:Cul2 APN 18 3,431,029 (GRCm39) missense probably benign 0.00
IGL03409:Cul2 APN 18 3,429,593 (GRCm39) missense probably damaging 1.00
R0238:Cul2 UTSW 18 3,414,115 (GRCm39) splice site probably benign
R1013:Cul2 UTSW 18 3,425,535 (GRCm39) nonsense probably null
R1119:Cul2 UTSW 18 3,419,335 (GRCm39) splice site probably benign
R1743:Cul2 UTSW 18 3,426,851 (GRCm39) missense probably damaging 1.00
R1897:Cul2 UTSW 18 3,414,164 (GRCm39) missense probably benign
R2252:Cul2 UTSW 18 3,399,876 (GRCm39) missense probably damaging 1.00
R2253:Cul2 UTSW 18 3,399,876 (GRCm39) missense probably damaging 1.00
R3898:Cul2 UTSW 18 3,434,033 (GRCm39) missense probably benign 0.07
R4386:Cul2 UTSW 18 3,434,856 (GRCm39) missense probably damaging 1.00
R4579:Cul2 UTSW 18 3,430,957 (GRCm39) missense probably benign 0.00
R4828:Cul2 UTSW 18 3,431,013 (GRCm39) missense probably damaging 1.00
R6085:Cul2 UTSW 18 3,431,508 (GRCm39) missense probably benign 0.01
R6429:Cul2 UTSW 18 3,421,345 (GRCm39) missense probably damaging 1.00
R6480:Cul2 UTSW 18 3,417,561 (GRCm39) missense possibly damaging 0.89
R6825:Cul2 UTSW 18 3,434,946 (GRCm39) missense probably damaging 0.99
R7343:Cul2 UTSW 18 3,426,873 (GRCm39) missense probably benign 0.08
R7690:Cul2 UTSW 18 3,419,420 (GRCm39) missense probably benign 0.09
R8114:Cul2 UTSW 18 3,426,164 (GRCm39) nonsense probably null
R8414:Cul2 UTSW 18 3,399,912 (GRCm39) missense probably benign 0.08
R8736:Cul2 UTSW 18 3,434,019 (GRCm39) missense probably damaging 0.99
R8849:Cul2 UTSW 18 3,423,551 (GRCm39) missense probably benign 0.00
R9199:Cul2 UTSW 18 3,423,577 (GRCm39) missense probably benign 0.00
R9443:Cul2 UTSW 18 3,434,041 (GRCm39) nonsense probably null
R9709:Cul2 UTSW 18 3,431,560 (GRCm39) missense probably damaging 1.00
X0067:Cul2 UTSW 18 3,419,435 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TCAGGGCATGTAGGTGACAG -3'
(R):5'- CCTTAAGGGAATATGTAATACACCAGG -3'

Sequencing Primer
(F):5'- CAGAGGTTAAGTTGATCTGAAATGAC -3'
(R):5'- TTAAATCTAAGGTAAGAGGAAACAGC -3'
Posted On 2018-09-12