Incidental Mutation 'R6807:Metap1d'
ID533570
Institutional Source Beutler Lab
Gene Symbol Metap1d
Ensembl Gene ENSMUSG00000041921
Gene Namemethionyl aminopeptidase type 1D (mitochondrial)
Synonyms2310066F24Rik, Metapl1, 3110033D18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R6807 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location71453276-71525194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71511514 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 151 (V151I)
Ref Sequence ENSEMBL: ENSMUSP00000048190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037210]
Predicted Effect probably damaging
Transcript: ENSMUST00000037210
AA Change: V151I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048190
Gene: ENSMUSG00000041921
AA Change: V151I

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 49 65 N/A INTRINSIC
Pfam:Peptidase_M24 95 322 5.1e-56 PFAM
Meta Mutation Damage Score 0.0805 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.9%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-terminal methionine excision pathway is an essential process in which the N-terminal methionine is removed from many proteins, thus facilitating subsequent protein modification. In mitochondria, enzymes that catalyze this reaction are celled methionine aminopeptidases (MetAps, or MAPs; EC 3.4.11.18) (Serero et al., 2003 [PubMed 14532271]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,391,530 T2158A probably benign Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Apol7a T C 15: 77,393,320 probably null Het
Bicdl1 C T 5: 115,672,143 probably null Het
Bop1 T A 15: 76,454,983 Q362L probably damaging Het
C4b T C 17: 34,730,956 D1418G probably benign Het
Cdh23 A G 10: 60,378,871 V1455A possibly damaging Het
Cecr2 T G 6: 120,734,542 probably null Het
Cer1 T C 4: 82,882,815 S204G probably benign Het
Cers3 G C 7: 66,764,220 W15C probably damaging Het
Csn1s2a A T 5: 87,781,872 H110L probably benign Het
Dnah10 T G 5: 124,790,000 probably null Het
Dync2h1 T C 9: 7,041,718 N3315S probably benign Het
Dynlrb2 T C 8: 116,507,560 M21T probably benign Het
Emilin1 T A 5: 30,915,527 F103I probably benign Het
Esrra T A 19: 6,911,774 M416L probably benign Het
Etaa1 C A 11: 17,952,680 V86L probably benign Het
Extl3 A G 14: 65,076,762 S324P probably damaging Het
Fam90a1a T C 8: 21,963,352 V241A probably benign Het
Fat4 C A 3: 38,982,440 Q3414K probably benign Het
Gm12166 T C 11: 46,052,032 Q88R probably damaging Het
Gm13101 A G 4: 143,965,011 S381P probably damaging Het
Gpr162 C T 6: 124,861,201 R162H probably damaging Het
Gpr21 T A 2: 37,517,962 Y173* probably null Het
Gprc6a G A 10: 51,626,745 Q341* probably null Het
Herc2 T A 7: 56,164,922 S2674R probably damaging Het
Hnrnpdl A T 5: 100,039,136 H9Q probably null Het
Hps1 A G 19: 42,770,778 V125A possibly damaging Het
Iba57 G T 11: 59,158,614 P243H probably damaging Het
Incenp G T 19: 9,877,756 A597E unknown Het
Kat6a T A 8: 22,940,368 M1913K unknown Het
Klb G A 5: 65,379,534 V736M probably damaging Het
Krt33a T A 11: 100,012,383 T278S possibly damaging Het
Krt73 T G 15: 101,796,407 E348A probably damaging Het
Lig3 T A 11: 82,783,751 D134E probably benign Het
Limd2 T C 11: 106,158,945 T73A probably benign Het
Lrpprc A G 17: 84,749,103 S787P possibly damaging Het
Macf1 A G 4: 123,374,415 M6735T probably damaging Het
Mapkbp1 C A 2: 120,021,159 Q861K probably damaging Het
Mc4r T A 18: 66,859,856 N62I probably damaging Het
Nek2 T C 1: 191,822,617 V147A probably damaging Het
Nlrp1b A T 11: 71,217,704 W324R probably damaging Het
Nol4l G T 2: 153,483,826 S113* probably null Het
Oc90 T A 15: 65,889,614 D185V probably damaging Het
Olfr1025-ps1 A T 2: 85,918,038 T38S possibly damaging Het
Olfr1243 G A 2: 89,527,588 T274M probably damaging Het
Olfr150 A T 9: 39,737,618 K268* probably null Het
Olfr437 T C 6: 43,167,238 F60S probably damaging Het
Olfr470 T A 7: 107,845,590 T48S possibly damaging Het
Olfr56 G A 11: 49,134,978 R262K probably damaging Het
Pcdha8 A G 18: 36,994,348 T628A probably damaging Het
Pcsk5 A T 19: 17,572,622 probably null Het
Pdgfrb T C 18: 61,078,649 probably null Het
Pgm3 A T 9: 86,556,502 probably null Het
Pin1rt1 T A 2: 104,714,718 Y23F probably benign Het
Poli T A 18: 70,530,151 probably null Het
Pom121 C A 5: 135,381,124 probably benign Het
Ppp2r5c A G 12: 110,569,022 D407G possibly damaging Het
Rgs12 A G 5: 35,023,171 D116G probably null Het
Serpina3b A T 12: 104,132,992 E255D probably benign Het
Slc46a1 A G 11: 78,466,964 H281R probably damaging Het
Spata6 T C 4: 111,784,815 I294T probably benign Het
Srgap1 T A 10: 121,828,726 probably null Het
Stag1 C T 9: 100,944,850 R957C probably damaging Het
Stk35 G A 2: 129,801,653 E186K probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tenm4 G A 7: 96,895,271 V2165I probably damaging Het
Tmem53 T C 4: 117,268,331 S207P probably benign Het
Ugt2a3 A G 5: 87,336,758 F136L probably benign Het
Unc13d T C 11: 116,066,751 K795E probably damaging Het
Zbtb11 C A 16: 55,990,502 T341K probably benign Het
Other mutations in Metap1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Metap1d APN 2 71512162 missense probably damaging 1.00
IGL00475:Metap1d APN 2 71515746 missense probably damaging 1.00
IGL01733:Metap1d APN 2 71511433 missense probably damaging 1.00
R6807_Metap1d_570 UTSW 2 71511514 missense probably damaging 1.00
R0294:Metap1d UTSW 2 71522545 missense probably benign
R1678:Metap1d UTSW 2 71524777 missense possibly damaging 0.95
R1917:Metap1d UTSW 2 71511527 missense probably damaging 1.00
R1934:Metap1d UTSW 2 71522583 missense possibly damaging 0.95
R2179:Metap1d UTSW 2 71453371 missense probably benign
R2512:Metap1d UTSW 2 71522610 missense probably damaging 0.97
R4614:Metap1d UTSW 2 71524948 missense probably benign 0.02
R4695:Metap1d UTSW 2 71524961 makesense probably null
R6236:Metap1d UTSW 2 71515678 missense probably benign 0.05
R6248:Metap1d UTSW 2 71515760 nonsense probably null
R7296:Metap1d UTSW 2 71506785 missense probably benign 0.05
R7796:Metap1d UTSW 2 71512162 missense probably damaging 1.00
R8183:Metap1d UTSW 2 71506863 missense possibly damaging 0.66
R8337:Metap1d UTSW 2 71515638 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGGTCTCACCTTGGCAGC -3'
(R):5'- ACATCAAATGGTAGTGGTACAGC -3'

Sequencing Primer
(F):5'- CAGCGCCGTTGTTGTGG -3'
(R):5'- AGCCAGGAAGAAGTAAAATACCTC -3'
Posted On2018-09-12