Incidental Mutation 'R6807:Olfr1025-ps1'
ID533571
Institutional Source Beutler Lab
Gene Symbol Olfr1025-ps1
Ensembl Gene ENSMUSG00000058884
Gene Nameolfactory receptor 1025, pseudogene 1
SynonymsMOR196-6_p, GA_x6K02T2Q125-47397266-47398205, MOR196-5P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6807 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85915193-85921381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85918038 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 38 (T38S)
Ref Sequence ENSEMBL: ENSMUSP00000149785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000188749] [ENSMUST00000213474] [ENSMUST00000217615] [ENSMUST00000219615]
Predicted Effect possibly damaging
Transcript: ENSMUST00000188749
AA Change: T38S

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139860
Gene: ENSMUSG00000058884
AA Change: T38S

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
Pfam:7tm_1 41 290 5.7e-30 PFAM
Pfam:7tm_4 139 283 7.8e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213474
AA Change: T38S

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000217615
Predicted Effect probably benign
Transcript: ENSMUST00000219615
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.9%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,391,530 T2158A probably benign Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Apol7a T C 15: 77,393,320 probably null Het
Bicdl1 C T 5: 115,672,143 probably null Het
Bop1 T A 15: 76,454,983 Q362L probably damaging Het
C4b T C 17: 34,730,956 D1418G probably benign Het
Cdh23 A G 10: 60,378,871 V1455A possibly damaging Het
Cecr2 T G 6: 120,734,542 probably null Het
Cer1 T C 4: 82,882,815 S204G probably benign Het
Cers3 G C 7: 66,764,220 W15C probably damaging Het
Csn1s2a A T 5: 87,781,872 H110L probably benign Het
Dnah10 T G 5: 124,790,000 probably null Het
Dync2h1 T C 9: 7,041,718 N3315S probably benign Het
Dynlrb2 T C 8: 116,507,560 M21T probably benign Het
Emilin1 T A 5: 30,915,527 F103I probably benign Het
Esrra T A 19: 6,911,774 M416L probably benign Het
Etaa1 C A 11: 17,952,680 V86L probably benign Het
Extl3 A G 14: 65,076,762 S324P probably damaging Het
Fam90a1a T C 8: 21,963,352 V241A probably benign Het
Fat4 C A 3: 38,982,440 Q3414K probably benign Het
Gm12166 T C 11: 46,052,032 Q88R probably damaging Het
Gm13101 A G 4: 143,965,011 S381P probably damaging Het
Gpr162 C T 6: 124,861,201 R162H probably damaging Het
Gpr21 T A 2: 37,517,962 Y173* probably null Het
Gprc6a G A 10: 51,626,745 Q341* probably null Het
Herc2 T A 7: 56,164,922 S2674R probably damaging Het
Hnrnpdl A T 5: 100,039,136 H9Q probably null Het
Hps1 A G 19: 42,770,778 V125A possibly damaging Het
Iba57 G T 11: 59,158,614 P243H probably damaging Het
Incenp G T 19: 9,877,756 A597E unknown Het
Kat6a T A 8: 22,940,368 M1913K unknown Het
Klb G A 5: 65,379,534 V736M probably damaging Het
Krt33a T A 11: 100,012,383 T278S possibly damaging Het
Krt73 T G 15: 101,796,407 E348A probably damaging Het
Lig3 T A 11: 82,783,751 D134E probably benign Het
Limd2 T C 11: 106,158,945 T73A probably benign Het
Lrpprc A G 17: 84,749,103 S787P possibly damaging Het
Macf1 A G 4: 123,374,415 M6735T probably damaging Het
Mapkbp1 C A 2: 120,021,159 Q861K probably damaging Het
Mc4r T A 18: 66,859,856 N62I probably damaging Het
Metap1d G A 2: 71,511,514 V151I probably damaging Het
Nek2 T C 1: 191,822,617 V147A probably damaging Het
Nlrp1b A T 11: 71,217,704 W324R probably damaging Het
Nol4l G T 2: 153,483,826 S113* probably null Het
Oc90 T A 15: 65,889,614 D185V probably damaging Het
Olfr1243 G A 2: 89,527,588 T274M probably damaging Het
Olfr150 A T 9: 39,737,618 K268* probably null Het
Olfr437 T C 6: 43,167,238 F60S probably damaging Het
Olfr470 T A 7: 107,845,590 T48S possibly damaging Het
Olfr56 G A 11: 49,134,978 R262K probably damaging Het
Pcdha8 A G 18: 36,994,348 T628A probably damaging Het
Pcsk5 A T 19: 17,572,622 probably null Het
Pdgfrb T C 18: 61,078,649 probably null Het
Pgm3 A T 9: 86,556,502 probably null Het
Pin1rt1 T A 2: 104,714,718 Y23F probably benign Het
Poli T A 18: 70,530,151 probably null Het
Pom121 C A 5: 135,381,124 probably benign Het
Ppp2r5c A G 12: 110,569,022 D407G possibly damaging Het
Rgs12 A G 5: 35,023,171 D116G probably null Het
Serpina3b A T 12: 104,132,992 E255D probably benign Het
Slc46a1 A G 11: 78,466,964 H281R probably damaging Het
Spata6 T C 4: 111,784,815 I294T probably benign Het
Srgap1 T A 10: 121,828,726 probably null Het
Stag1 C T 9: 100,944,850 R957C probably damaging Het
Stk35 G A 2: 129,801,653 E186K probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tenm4 G A 7: 96,895,271 V2165I probably damaging Het
Tmem53 T C 4: 117,268,331 S207P probably benign Het
Ugt2a3 A G 5: 87,336,758 F136L probably benign Het
Unc13d T C 11: 116,066,751 K795E probably damaging Het
Zbtb11 C A 16: 55,990,502 T341K probably benign Het
Other mutations in Olfr1025-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Olfr1025-ps1 APN 2 85918564 missense probably benign 0.25
IGL02881:Olfr1025-ps1 APN 2 85918116 missense probably benign 0.00
R0097:Olfr1025-ps1 UTSW 2 85918840 missense probably benign 0.00
R0097:Olfr1025-ps1 UTSW 2 85918840 missense probably benign 0.00
R0324:Olfr1025-ps1 UTSW 2 85917951 missense probably benign 0.22
R0392:Olfr1025-ps1 UTSW 2 85918762 missense possibly damaging 0.81
R0765:Olfr1025-ps1 UTSW 2 85918705 missense probably damaging 0.99
R1199:Olfr1025-ps1 UTSW 2 85918035 missense probably benign 0.00
R1894:Olfr1025-ps1 UTSW 2 85918255 missense probably benign 0.28
R2027:Olfr1025-ps1 UTSW 2 85918770 missense probably damaging 0.99
R2141:Olfr1025-ps1 UTSW 2 85918827 missense probably null
R3871:Olfr1025-ps1 UTSW 2 85918582 unclassified probably null
R4837:Olfr1025-ps1 UTSW 2 85918404 missense probably benign 0.00
R4945:Olfr1025-ps1 UTSW 2 85918573 missense possibly damaging 0.81
R5056:Olfr1025-ps1 UTSW 2 85918136 missense probably damaging 1.00
R5441:Olfr1025-ps1 UTSW 2 85918590 missense probably benign 0.01
R5960:Olfr1025-ps1 UTSW 2 85918725 missense probably benign 0.07
R7320:Olfr1025-ps1 UTSW 2 85918374 missense probably benign 0.00
V1662:Olfr1025-ps1 UTSW 2 85918594 missense probably benign 0.10
Z1176:Olfr1025-ps1 UTSW 2 85918501 missense not run
Predicted Primers PCR Primer
(F):5'- CTAGATAACATGATTGGGGATAATGAA -3'
(R):5'- TGAAACTGTATGAAGCAGCCTAT -3'

Sequencing Primer
(F):5'- ACTACACAGCAGTGACTG -3'
(R):5'- CTGTATGAAGCAGCCTATGAAAG -3'
Posted On2018-09-12