Mutagenetix > Incidental Mutations

Incidental Mutation 'R6807:Stk35'

533575

Institutional Source

Beutler Lab

Gene Symbol

Stk35

Ensembl Gene

ENSMUSG00000037885

Gene Name

serine/threonine kinase 35

Synonyms

1700054C12Rik, CLIK1, CLP-36 interacting kinase

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6807 (G1)

Quality Score

189.009

Status

Validated

Chromosome

Chromosomal Location

129800517-129832287 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 129801653 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 186 (E186K)

Ref Sequence

ENSEMBL: ENSMUSP00000132862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165413] [ENSMUST00000166282]

AlphaFold

Q80ZW0

Predicted Effect

probably damaging
Transcript: ENSMUST00000165413
AA Change: E186K

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000126541
Gene: ENSMUSG00000037885
AA Change: E186K

Domain	Start	End	E-Value	Type
low complexity region	51	69	N/A	INTRINSIC
low complexity region	115	137	N/A	INTRINSIC
low complexity region	190	206	N/A	INTRINSIC
Pfam:Pkinase_Tyr	207	295	2e-6	PFAM
Pfam:Pkinase	207	531	8.6e-51	PFAM
Pfam:Pkinase_Tyr	304	532	2.1e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000166282
AA Change: E186K

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000132862
Gene: ENSMUSG00000037885
AA Change: E186K

Domain	Start	End	E-Value	Type
low complexity region	51	69	N/A	INTRINSIC
low complexity region	115	137	N/A	INTRINSIC
low complexity region	190	206	N/A	INTRINSIC
Pfam:Pkinase_Tyr	207	300	5.9e-7	PFAM
Pfam:Pkinase	207	311	1e-9	PFAM

Meta Mutation Damage Score

0.0972

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.9%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinase that is predominantly found in the nucleus. However, it can interact with PDLIM1/CLP-36 in the cytoplasm and localize to actin stress fibers. The encoded protein may be a regulator of actin stress fibers in nonmuscle cells. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	A	G	11: 84,391,530	T2158A	probably benign	Het
Apeh	G	A	9: 108,092,679	H186Y	probably damaging	Het
Apol7a	T	C	15: 77,393,320		probably null	Het
Bicdl1	C	T	5: 115,672,143		probably null	Het
Bop1	T	A	15: 76,454,983	Q362L	probably damaging	Het
C4b	T	C	17: 34,730,956	D1418G	probably benign	Het
Cdh23	A	G	10: 60,378,871	V1455A	possibly damaging	Het
Cecr2	T	G	6: 120,734,542		probably null	Het
Cer1	T	C	4: 82,882,815	S204G	probably benign	Het
Cers3	G	C	7: 66,764,220	W15C	probably damaging	Het
Csn1s2a	A	T	5: 87,781,872	H110L	probably benign	Het
Dnah10	T	G	5: 124,790,000		probably null	Het
Dync2h1	T	C	9: 7,041,718	N3315S	probably benign	Het
Dynlrb2	T	C	8: 116,507,560	M21T	probably benign	Het
Emilin1	T	A	5: 30,915,527	F103I	probably benign	Het
Esrra	T	A	19: 6,911,774	M416L	probably benign	Het
Etaa1	C	A	11: 17,952,680	V86L	probably benign	Het
Extl3	A	G	14: 65,076,762	S324P	probably damaging	Het
Fam90a1a	T	C	8: 21,963,352	V241A	probably benign	Het
Fat4	C	A	3: 38,982,440	Q3414K	probably benign	Het
Gm12166	T	C	11: 46,052,032	Q88R	probably damaging	Het
Gm13101	A	G	4: 143,965,011	S381P	probably damaging	Het
Gpr162	C	T	6: 124,861,201	R162H	probably damaging	Het
Gpr21	T	A	2: 37,517,962	Y173*	probably null	Het
Gprc6a	G	A	10: 51,626,745	Q341*	probably null	Het
Herc2	T	A	7: 56,164,922	S2674R	probably damaging	Het
Hnrnpdl	A	T	5: 100,039,136	H9Q	probably null	Het
Hps1	A	G	19: 42,770,778	V125A	possibly damaging	Het
Iba57	G	T	11: 59,158,614	P243H	probably damaging	Het
Incenp	G	T	19: 9,877,756	A597E	unknown	Het
Kat6a	T	A	8: 22,940,368	M1913K	unknown	Het
Klb	G	A	5: 65,379,534	V736M	probably damaging	Het
Krt33a	T	A	11: 100,012,383	T278S	possibly damaging	Het
Krt73	T	G	15: 101,796,407	E348A	probably damaging	Het
Lig3	T	A	11: 82,783,751	D134E	probably benign	Het
Limd2	T	C	11: 106,158,945	T73A	probably benign	Het
Lrpprc	A	G	17: 84,749,103	S787P	possibly damaging	Het
Macf1	A	G	4: 123,374,415	M6735T	probably damaging	Het
Mapkbp1	C	A	2: 120,021,159	Q861K	probably damaging	Het
Mc4r	T	A	18: 66,859,856	N62I	probably damaging	Het
Metap1d	G	A	2: 71,511,514	V151I	probably damaging	Het
Nek2	T	C	1: 191,822,617	V147A	probably damaging	Het
Nlrp1b	A	T	11: 71,217,704	W324R	probably damaging	Het
Nol4l	G	T	2: 153,483,826	S113*	probably null	Het
Oc90	T	A	15: 65,889,614	D185V	probably damaging	Het
Olfr1025-ps1	A	T	2: 85,918,038	T38S	possibly damaging	Het
Olfr1243	G	A	2: 89,527,588	T274M	probably damaging	Het
Olfr150	A	T	9: 39,737,618	K268*	probably null	Het
Olfr437	T	C	6: 43,167,238	F60S	probably damaging	Het
Olfr470	T	A	7: 107,845,590	T48S	possibly damaging	Het
Olfr56	G	A	11: 49,134,978	R262K	probably damaging	Het
Pcdha8	A	G	18: 36,994,348	T628A	probably damaging	Het
Pcsk5	A	T	19: 17,572,622		probably null	Het
Pdgfrb	T	C	18: 61,078,649		probably null	Het
Pgm3	A	T	9: 86,556,502		probably null	Het
Pin1rt1	T	A	2: 104,714,718	Y23F	probably benign	Het
Poli	T	A	18: 70,530,151		probably null	Het
Pom121	C	A	5: 135,381,124		probably benign	Het
Ppp2r5c	A	G	12: 110,569,022	D407G	possibly damaging	Het
Rgs12	A	G	5: 35,023,171	D116G	probably null	Het
Serpina3b	A	T	12: 104,132,992	E255D	probably benign	Het
Slc46a1	A	G	11: 78,466,964	H281R	probably damaging	Het
Spata6	T	C	4: 111,784,815	I294T	probably benign	Het
Srgap1	T	A	10: 121,828,726		probably null	Het
Stag1	C	T	9: 100,944,850	R957C	probably damaging	Het
Tenm4	G	A	7: 96,895,271	V2165I	probably damaging	Het
Tenm4	G	A	7: 96,553,496	R106H	probably benign	Het
Tmem53	T	C	4: 117,268,331	S207P	probably benign	Het
Ugt2a3	A	G	5: 87,336,758	F136L	probably benign	Het
Unc13d	T	C	11: 116,066,751	K795E	probably damaging	Het
Zbtb11	C	A	16: 55,990,502	T341K	probably benign	Het

Other mutations in Stk35

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Stk35	APN	2	129801992	missense	probably damaging	1.00
IGL02609:Stk35	APN	2	129801801	missense	probably damaging	1.00
fingernails	UTSW	2	129810935	missense	probably damaging	1.00
R2256_Stk35_331	UTSW	2	129810507	nonsense	probably null
skinned	UTSW	2	129811235	intron	probably benign
R0045:Stk35	UTSW	2	129800568	nonsense	probably null
R0306:Stk35	UTSW	2	129801763	nonsense	probably null
R0784:Stk35	UTSW	2	129810802	nonsense	probably null
R1536:Stk35	UTSW	2	129811235	intron	probably benign
R2256:Stk35	UTSW	2	129810507	nonsense	probably null
R2507:Stk35	UTSW	2	129801515	missense	probably damaging	0.97
R2508:Stk35	UTSW	2	129801515	missense	probably damaging	0.97
R3848:Stk35	UTSW	2	129800736	missense	probably benign	0.13
R3872:Stk35	UTSW	2	129810575	missense	possibly damaging	0.82
R4466:Stk35	UTSW	2	129801516	missense	probably damaging	0.99
R5144:Stk35	UTSW	2	129810935	missense	probably damaging	1.00
R6267:Stk35	UTSW	2	129810888	nonsense	probably null
R6296:Stk35	UTSW	2	129810888	nonsense	probably null
R6480:Stk35	UTSW	2	129810687	missense	possibly damaging	0.95
R7203:Stk35	UTSW	2	129801593	missense	probably benign
R7476:Stk35	UTSW	2	129810725	missense	probably damaging	1.00
R8505:Stk35	UTSW	2	129801729	missense	probably damaging	0.99
R8998:Stk35	UTSW	2	129810589	missense	probably damaging	1.00
R8999:Stk35	UTSW	2	129810589	missense	probably damaging	1.00
R9224:Stk35	UTSW	2	129810571	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTAGATCACCATCCAAGGTCCC -3'
(R):5'- TCGCAGCGGATCTTCTTGAC -3'

Sequencing Primer
(F):5'- TCCACATCTCGGGGCTAGAC -3'
(R):5'- AGCGGATCTTCTTGACTGCCAC -3'

Posted On

2018-09-12