Mutagenetix > Incidental Mutations

Incidental Mutation 'R6807:Cecr2'

533592

Institutional Source

Beutler Lab

Gene Symbol

Cecr2

Ensembl Gene

ENSMUSG00000071226

Gene Name

CECR2, histone acetyl-lysine reader

Synonyms

Gtl4, 2610101O16Rik, 2810409N01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6807 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120666369-120771190 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to G at 120734542 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000108306 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100993] [ENSMUST00000112686] [ENSMUST00000129803]

Predicted Effect

probably null
Transcript: ENSMUST00000100993

SMART Domains

Protein: ENSMUSP00000098556
Gene: ENSMUSG00000071226

Domain	Start	End	E-Value	Type
low complexity region	4	14	N/A	INTRINSIC
low complexity region	194	209	N/A	INTRINSIC
low complexity region	211	222	N/A	INTRINSIC
Pfam:WHIM3	244	284	5.2e-11	PFAM
coiled coil region	322	382	N/A	INTRINSIC
BROMO	416	520	5.09e-32	SMART
low complexity region	536	551	N/A	INTRINSIC
low complexity region	781	796	N/A	INTRINSIC
low complexity region	839	855	N/A	INTRINSIC
low complexity region	890	907	N/A	INTRINSIC
low complexity region	1173	1187	N/A	INTRINSIC
low complexity region	1202	1223	N/A	INTRINSIC
low complexity region	1355	1366	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000112686

SMART Domains

Protein: ENSMUSP00000108306
Gene: ENSMUSG00000071226

Domain	Start	End	E-Value	Type
low complexity region	4	14	N/A	INTRINSIC
low complexity region	194	209	N/A	INTRINSIC
low complexity region	211	222	N/A	INTRINSIC
coiled coil region	322	382	N/A	INTRINSIC
BROMO	416	520	5.09e-32	SMART
low complexity region	536	551	N/A	INTRINSIC
low complexity region	753	768	N/A	INTRINSIC
low complexity region	811	827	N/A	INTRINSIC
low complexity region	862	879	N/A	INTRINSIC
low complexity region	1145	1159	N/A	INTRINSIC
low complexity region	1174	1195	N/A	INTRINSIC
low complexity region	1327	1338	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129803

SMART Domains

Protein: ENSMUSP00000118542
Gene: ENSMUSG00000071226

Domain	Start	End	E-Value	Type
low complexity region	7	18	N/A	INTRINSIC
coiled coil region	90	150	N/A	INTRINSIC
Pfam:Bromodomain	191	234	1.1e-9	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.9%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that is involved in chromatin remodeling, and may additionally play a role in DNA damage response. The encoded protein functions as part of an ATP-dependent complex that is involved in neurulation. This gene is a candidate gene for Cat Eye Syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice display varied penetrance of exencephaly depending on genetic background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	A	G	11: 84,391,530	T2158A	probably benign	Het
Apeh	G	A	9: 108,092,679	H186Y	probably damaging	Het
Apol7a	T	C	15: 77,393,320		probably null	Het
Bicdl1	C	T	5: 115,672,143		probably null	Het
Bop1	T	A	15: 76,454,983	Q362L	probably damaging	Het
C4b	T	C	17: 34,730,956	D1418G	probably benign	Het
Cdh23	A	G	10: 60,378,871	V1455A	possibly damaging	Het
Cer1	T	C	4: 82,882,815	S204G	probably benign	Het
Cers3	G	C	7: 66,764,220	W15C	probably damaging	Het
Csn1s2a	A	T	5: 87,781,872	H110L	probably benign	Het
Dnah10	T	G	5: 124,790,000		probably null	Het
Dync2h1	T	C	9: 7,041,718	N3315S	probably benign	Het
Dynlrb2	T	C	8: 116,507,560	M21T	probably benign	Het
Emilin1	T	A	5: 30,915,527	F103I	probably benign	Het
Esrra	T	A	19: 6,911,774	M416L	probably benign	Het
Etaa1	C	A	11: 17,952,680	V86L	probably benign	Het
Extl3	A	G	14: 65,076,762	S324P	probably damaging	Het
Fam90a1a	T	C	8: 21,963,352	V241A	probably benign	Het
Fat4	C	A	3: 38,982,440	Q3414K	probably benign	Het
Gm12166	T	C	11: 46,052,032	Q88R	probably damaging	Het
Gm13101	A	G	4: 143,965,011	S381P	probably damaging	Het
Gpr162	C	T	6: 124,861,201	R162H	probably damaging	Het
Gpr21	T	A	2: 37,517,962	Y173*	probably null	Het
Gprc6a	G	A	10: 51,626,745	Q341*	probably null	Het
Herc2	T	A	7: 56,164,922	S2674R	probably damaging	Het
Hnrnpdl	A	T	5: 100,039,136	H9Q	probably null	Het
Hps1	A	G	19: 42,770,778	V125A	possibly damaging	Het
Iba57	G	T	11: 59,158,614	P243H	probably damaging	Het
Incenp	G	T	19: 9,877,756	A597E	unknown	Het
Kat6a	T	A	8: 22,940,368	M1913K	unknown	Het
Klb	G	A	5: 65,379,534	V736M	probably damaging	Het
Krt33a	T	A	11: 100,012,383	T278S	possibly damaging	Het
Krt73	T	G	15: 101,796,407	E348A	probably damaging	Het
Lig3	T	A	11: 82,783,751	D134E	probably benign	Het
Limd2	T	C	11: 106,158,945	T73A	probably benign	Het
Lrpprc	A	G	17: 84,749,103	S787P	possibly damaging	Het
Macf1	A	G	4: 123,374,415	M6735T	probably damaging	Het
Mapkbp1	C	A	2: 120,021,159	Q861K	probably damaging	Het
Mc4r	T	A	18: 66,859,856	N62I	probably damaging	Het
Metap1d	G	A	2: 71,511,514	V151I	probably damaging	Het
Nek2	T	C	1: 191,822,617	V147A	probably damaging	Het
Nlrp1b	A	T	11: 71,217,704	W324R	probably damaging	Het
Nol4l	G	T	2: 153,483,826	S113*	probably null	Het
Oc90	T	A	15: 65,889,614	D185V	probably damaging	Het
Olfr1025-ps1	A	T	2: 85,918,038	T38S	possibly damaging	Het
Olfr1243	G	A	2: 89,527,588	T274M	probably damaging	Het
Olfr150	A	T	9: 39,737,618	K268*	probably null	Het
Olfr437	T	C	6: 43,167,238	F60S	probably damaging	Het
Olfr470	T	A	7: 107,845,590	T48S	possibly damaging	Het
Olfr56	G	A	11: 49,134,978	R262K	probably damaging	Het
Pcdha8	A	G	18: 36,994,348	T628A	probably damaging	Het
Pcsk5	A	T	19: 17,572,622		probably null	Het
Pdgfrb	T	C	18: 61,078,649		probably null	Het
Pgm3	A	T	9: 86,556,502		probably null	Het
Pin1rt1	T	A	2: 104,714,718	Y23F	probably benign	Het
Poli	T	A	18: 70,530,151		probably null	Het
Pom121	C	A	5: 135,381,124		probably benign	Het
Ppp2r5c	A	G	12: 110,569,022	D407G	possibly damaging	Het
Rgs12	A	G	5: 35,023,171	D116G	probably null	Het
Serpina3b	A	T	12: 104,132,992	E255D	probably benign	Het
Slc46a1	A	G	11: 78,466,964	H281R	probably damaging	Het
Spata6	T	C	4: 111,784,815	I294T	probably benign	Het
Srgap1	T	A	10: 121,828,726		probably null	Het
Stag1	C	T	9: 100,944,850	R957C	probably damaging	Het
Stk35	G	A	2: 129,801,653	E186K	probably damaging	Het
Tenm4	G	A	7: 96,553,496	R106H	probably benign	Het
Tenm4	G	A	7: 96,895,271	V2165I	probably damaging	Het
Tmem53	T	C	4: 117,268,331	S207P	probably benign	Het
Ugt2a3	A	G	5: 87,336,758	F136L	probably benign	Het
Unc13d	T	C	11: 116,066,751	K795E	probably damaging	Het
Zbtb11	C	A	16: 55,990,502	T341K	probably benign	Het

Other mutations in Cecr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Cecr2	APN	6	120756717	missense	probably damaging	1.00
IGL00782:Cecr2	APN	6	120761621	missense	probably benign	0.00
IGL01137:Cecr2	APN	6	120762028	missense	probably damaging	1.00
IGL01446:Cecr2	APN	6	120758599	missense	probably benign
IGL02108:Cecr2	APN	6	120762558	critical splice donor site	probably null
IGL02195:Cecr2	APN	6	120731406	missense	probably damaging	1.00
IGL02689:Cecr2	APN	6	120762167	missense	probably damaging	1.00
IGL03189:Cecr2	APN	6	120762430	missense	probably benign	0.13
PIT1430001:Cecr2	UTSW	6	120758479	missense	probably benign	0.01
R0200:Cecr2	UTSW	6	120761797	missense	probably damaging	1.00
R0586:Cecr2	UTSW	6	120757884	missense	probably damaging	1.00
R0715:Cecr2	UTSW	6	120758198	missense	probably benign	0.21
R0784:Cecr2	UTSW	6	120758149	missense	possibly damaging	0.74
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1343:Cecr2	UTSW	6	120754711	missense	probably damaging	0.99
R1349:Cecr2	UTSW	6	120757603	missense	probably damaging	0.99
R1386:Cecr2	UTSW	6	120762131	missense	probably damaging	1.00
R1438:Cecr2	UTSW	6	120761472	nonsense	probably null
R1602:Cecr2	UTSW	6	120755587	missense	possibly damaging	0.52
R1664:Cecr2	UTSW	6	120762026	missense	probably damaging	0.96
R1731:Cecr2	UTSW	6	120758180	missense	possibly damaging	0.74
R1817:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1818:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1819:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1862:Cecr2	UTSW	6	120757941	missense	probably damaging	1.00
R1907:Cecr2	UTSW	6	120761160	missense	probably benign	0.03
R1911:Cecr2	UTSW	6	120762565	unclassified	probably benign
R2135:Cecr2	UTSW	6	120720962	missense	probably damaging	1.00
R2273:Cecr2	UTSW	6	120756741	missense	probably benign	0.00
R2275:Cecr2	UTSW	6	120756741	missense	probably benign	0.00
R3713:Cecr2	UTSW	6	120758260	missense	probably damaging	1.00
R4271:Cecr2	UTSW	6	120762475	missense	probably damaging	1.00
R4706:Cecr2	UTSW	6	120755578	missense	possibly damaging	0.73
R4873:Cecr2	UTSW	6	120750916	missense	probably damaging	0.99
R4875:Cecr2	UTSW	6	120750916	missense	probably damaging	0.99
R5137:Cecr2	UTSW	6	120755517	missense	probably benign
R5153:Cecr2	UTSW	6	120734560	missense	probably benign	0.03
R5377:Cecr2	UTSW	6	120756569	missense	possibly damaging	0.87
R5598:Cecr2	UTSW	6	120731446	splice site	probably null
R5651:Cecr2	UTSW	6	120755560	missense	probably damaging	0.96
R5680:Cecr2	UTSW	6	120761426	missense	probably benign
R5813:Cecr2	UTSW	6	120762208	missense	probably damaging	0.99
R5970:Cecr2	UTSW	6	120720907	missense	probably damaging	0.98
R6255:Cecr2	UTSW	6	120758050	missense	probably damaging	1.00
R6266:Cecr2	UTSW	6	120761686	missense	probably benign
R6630:Cecr2	UTSW	6	120762178	missense	probably damaging	1.00
R6737:Cecr2	UTSW	6	120737123	missense	possibly damaging	0.86
R6754:Cecr2	UTSW	6	120757578	missense	probably damaging	0.98
R7187:Cecr2	UTSW	6	120756686	missense	probably benign
R7256:Cecr2	UTSW	6	120762529	missense	probably benign
R7282:Cecr2	UTSW	6	120761621	missense
R7548:Cecr2	UTSW	6	120761714	missense
R7596:Cecr2	UTSW	6	120762206	missense	probably benign
R7802:Cecr2	UTSW	6	120743847	missense	probably benign	0.45
R8112:Cecr2	UTSW	6	120762214	missense	probably benign	0.00
R8289:Cecr2	UTSW	6	120758116	missense	probably benign	0.24
R8294:Cecr2	UTSW	6	120733786	missense	probably damaging	0.99
R8470:Cecr2	UTSW	6	120756933	missense	probably benign	0.21
X0012:Cecr2	UTSW	6	120733774	missense	probably damaging	0.99
X0063:Cecr2	UTSW	6	120762071	missense	probably benign	0.01
Z1177:Cecr2	UTSW	6	120720962	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACCATTTGTTGCTAGGAAGGTG -3'
(R):5'- GAGGGGAAACTAAGGTACCTTC -3'

Sequencing Primer
(F):5'- CCATTTGTTGCTAGGAAGGTGTTAGG -3'
(R):5'- AGGTACCTTCTAGTATGAGAGAGTC -3'

Posted On

2018-09-12