Incidental Mutation 'R6807:Dync2h1'
ID 533602
Institutional Source Beutler Lab
Gene Symbol Dync2h1
Ensembl Gene ENSMUSG00000047193
Gene Name dynein cytoplasmic 2 heavy chain 1
Synonyms 4432416O06Rik, DHC2, D030010H02Rik, D330044F14Rik, Dnchc2, DHC1b, b2b414Clo
MMRRC Submission 044920-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6807 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 6928503-7184446 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 7041718 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 3315 (N3315S)
Ref Sequence ENSEMBL: ENSMUSP00000116679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048417] [ENSMUST00000140466] [ENSMUST00000147193]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000048417
AA Change: N3308S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000046733
Gene: ENSMUSG00000047193
AA Change: N3308S

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139671
SMART Domains Protein: ENSMUSP00000116242
Gene: ENSMUSG00000047193

DomainStartEndE-ValueType
low complexity region 59 73 N/A INTRINSIC
Pfam:AAA_8 89 352 3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140466
AA Change: N3308S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000120007
Gene: ENSMUSG00000047193
AA Change: N3308S

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147193
AA Change: N3315S

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116679
Gene: ENSMUSG00000047193
AA Change: N3315S

DomainStartEndE-ValueType
Pfam:DHC_N1 188 674 4e-45 PFAM
Pfam:DHC_N2 1118 1521 5.5e-111 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2880 4.4e-27 PFAM
Pfam:MT 2894 3230 1.3e-27 PFAM
Pfam:AAA_9 3246 3477 1e-79 PFAM
Pfam:Dynein_heavy 3618 4310 8.5e-158 PFAM
Meta Mutation Damage Score 0.1105 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.9%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large cytoplasmic dynein protein that is involved in retrograde transport in the cilium and has a role in intraflagellar transport, a process required for ciliary/flagellar assembly. Mutations in this gene cause a heterogeneous spectrum of conditions related to altered primary cilium function and often involve polydactyly, abnormal skeletogenesis, and polycystic kidneys. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a gene trap allele show complete embryonic lethality with altered heart looping and brain morphology. Chemically induced mutants show randomized heart looping and polydactyly. Holoprosencephaly or exencephaly, micrognathia, and cardiac, renal, airway and eye defects may be observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,391,530 (GRCm38) T2158A probably benign Het
Apeh G A 9: 108,092,679 (GRCm38) H186Y probably damaging Het
Apol7a T C 15: 77,393,320 (GRCm38) probably null Het
Bicdl1 C T 5: 115,672,143 (GRCm38) probably null Het
Bop1 T A 15: 76,454,983 (GRCm38) Q362L probably damaging Het
C4b T C 17: 34,730,956 (GRCm38) D1418G probably benign Het
Cdh23 A G 10: 60,378,871 (GRCm38) V1455A possibly damaging Het
Cecr2 T G 6: 120,734,542 (GRCm38) probably null Het
Cer1 T C 4: 82,882,815 (GRCm38) S204G probably benign Het
Cers3 G C 7: 66,764,220 (GRCm38) W15C probably damaging Het
Csn1s2a A T 5: 87,781,872 (GRCm38) H110L probably benign Het
Dnah10 T G 5: 124,790,000 (GRCm38) probably null Het
Dynlrb2 T C 8: 116,507,560 (GRCm38) M21T probably benign Het
Emilin1 T A 5: 30,915,527 (GRCm38) F103I probably benign Het
Esrra T A 19: 6,911,774 (GRCm38) M416L probably benign Het
Etaa1 C A 11: 17,952,680 (GRCm38) V86L probably benign Het
Extl3 A G 14: 65,076,762 (GRCm38) S324P probably damaging Het
Fam90a1a T C 8: 21,963,352 (GRCm38) V241A probably benign Het
Fat4 C A 3: 38,982,440 (GRCm38) Q3414K probably benign Het
Gm12166 T C 11: 46,052,032 (GRCm38) Q88R probably damaging Het
Gm13101 A G 4: 143,965,011 (GRCm38) S381P probably damaging Het
Gpr162 C T 6: 124,861,201 (GRCm38) R162H probably damaging Het
Gpr21 T A 2: 37,517,962 (GRCm38) Y173* probably null Het
Gprc6a G A 10: 51,626,745 (GRCm38) Q341* probably null Het
Herc2 T A 7: 56,164,922 (GRCm38) S2674R probably damaging Het
Hnrnpdl A T 5: 100,039,136 (GRCm38) H9Q probably null Het
Hps1 A G 19: 42,770,778 (GRCm38) V125A possibly damaging Het
Iba57 G T 11: 59,158,614 (GRCm38) P243H probably damaging Het
Incenp G T 19: 9,877,756 (GRCm38) A597E unknown Het
Kat6a T A 8: 22,940,368 (GRCm38) M1913K unknown Het
Klb G A 5: 65,379,534 (GRCm38) V736M probably damaging Het
Krt33a T A 11: 100,012,383 (GRCm38) T278S possibly damaging Het
Krt73 T G 15: 101,796,407 (GRCm38) E348A probably damaging Het
Lig3 T A 11: 82,783,751 (GRCm38) D134E probably benign Het
Limd2 T C 11: 106,158,945 (GRCm38) T73A probably benign Het
Lrpprc A G 17: 84,749,103 (GRCm38) S787P possibly damaging Het
Macf1 A G 4: 123,374,415 (GRCm38) M6735T probably damaging Het
Mapkbp1 C A 2: 120,021,159 (GRCm38) Q861K probably damaging Het
Mc4r T A 18: 66,859,856 (GRCm38) N62I probably damaging Het
Metap1d G A 2: 71,511,514 (GRCm38) V151I probably damaging Het
Nek2 T C 1: 191,822,617 (GRCm38) V147A probably damaging Het
Nlrp1b A T 11: 71,217,704 (GRCm38) W324R probably damaging Het
Nol4l G T 2: 153,483,826 (GRCm38) S113* probably null Het
Oc90 T A 15: 65,889,614 (GRCm38) D185V probably damaging Het
Olfr1025-ps1 A T 2: 85,918,038 (GRCm38) T38S possibly damaging Het
Olfr1243 G A 2: 89,527,588 (GRCm38) T274M probably damaging Het
Olfr150 A T 9: 39,737,618 (GRCm38) K268* probably null Het
Olfr437 T C 6: 43,167,238 (GRCm38) F60S probably damaging Het
Olfr470 T A 7: 107,845,590 (GRCm38) T48S possibly damaging Het
Olfr56 G A 11: 49,134,978 (GRCm38) R262K probably damaging Het
Pcdha8 A G 18: 36,994,348 (GRCm38) T628A probably damaging Het
Pcsk5 A T 19: 17,572,622 (GRCm38) probably null Het
Pdgfrb T C 18: 61,078,649 (GRCm38) probably null Het
Pgm3 A T 9: 86,556,502 (GRCm38) probably null Het
Pin1rt1 T A 2: 104,714,718 (GRCm38) Y23F probably benign Het
Poli T A 18: 70,530,151 (GRCm38) probably null Het
Pom121 C A 5: 135,381,124 (GRCm38) probably benign Het
Ppp2r5c A G 12: 110,569,022 (GRCm38) D407G possibly damaging Het
Rgs12 A G 5: 35,023,171 (GRCm38) D116G probably null Het
Serpina3b A T 12: 104,132,992 (GRCm38) E255D probably benign Het
Slc46a1 A G 11: 78,466,964 (GRCm38) H281R probably damaging Het
Spata6 T C 4: 111,784,815 (GRCm38) I294T probably benign Het
Srgap1 T A 10: 121,828,726 (GRCm38) probably null Het
Stag1 C T 9: 100,944,850 (GRCm38) R957C probably damaging Het
Stk35 G A 2: 129,801,653 (GRCm38) E186K probably damaging Het
Tenm4 G A 7: 96,895,271 (GRCm38) V2165I probably damaging Het
Tenm4 G A 7: 96,553,496 (GRCm38) R106H probably benign Het
Tmem53 T C 4: 117,268,331 (GRCm38) S207P probably benign Het
Ugt2a3 A G 5: 87,336,758 (GRCm38) F136L probably benign Het
Unc13d T C 11: 116,066,751 (GRCm38) K795E probably damaging Het
Zbtb11 C A 16: 55,990,502 (GRCm38) T341K probably benign Het
Other mutations in Dync2h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dync2h1 APN 9 7,158,839 (GRCm38) missense probably benign 0.42
IGL00310:Dync2h1 APN 9 7,155,072 (GRCm38) splice site probably benign
IGL00499:Dync2h1 APN 9 7,168,700 (GRCm38) missense possibly damaging 0.95
IGL00579:Dync2h1 APN 9 7,035,728 (GRCm38) splice site probably benign
IGL00660:Dync2h1 APN 9 7,075,797 (GRCm38) missense probably damaging 0.98
IGL00964:Dync2h1 APN 9 7,174,881 (GRCm38) splice site probably benign
IGL01025:Dync2h1 APN 9 7,162,789 (GRCm38) missense probably damaging 1.00
IGL01093:Dync2h1 APN 9 7,145,611 (GRCm38) missense probably benign 0.01
IGL01108:Dync2h1 APN 9 7,176,771 (GRCm38) missense possibly damaging 0.87
IGL01126:Dync2h1 APN 9 7,116,588 (GRCm38) missense probably benign 0.00
IGL01474:Dync2h1 APN 9 7,102,493 (GRCm38) missense probably benign 0.01
IGL01531:Dync2h1 APN 9 7,071,111 (GRCm38) missense probably benign 0.11
IGL01548:Dync2h1 APN 9 7,071,922 (GRCm38) missense probably damaging 1.00
IGL01621:Dync2h1 APN 9 7,140,897 (GRCm38) critical splice donor site probably null
IGL01672:Dync2h1 APN 9 7,118,884 (GRCm38) nonsense probably null
IGL01681:Dync2h1 APN 9 7,142,196 (GRCm38) splice site probably null
IGL01685:Dync2h1 APN 9 7,142,297 (GRCm38) missense probably damaging 1.00
IGL01724:Dync2h1 APN 9 7,081,077 (GRCm38) missense probably benign 0.03
IGL01738:Dync2h1 APN 9 7,114,922 (GRCm38) missense possibly damaging 0.77
IGL01783:Dync2h1 APN 9 7,118,822 (GRCm38) unclassified probably benign
IGL01813:Dync2h1 APN 9 7,122,799 (GRCm38) missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7,114,973 (GRCm38) missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7,011,207 (GRCm38) missense probably benign 0.33
IGL02105:Dync2h1 APN 9 7,075,892 (GRCm38) missense probably damaging 1.00
IGL02137:Dync2h1 APN 9 7,134,349 (GRCm38) missense probably benign
IGL02140:Dync2h1 APN 9 7,147,791 (GRCm38) missense probably benign
IGL02175:Dync2h1 APN 9 7,111,548 (GRCm38) missense possibly damaging 0.91
IGL02283:Dync2h1 APN 9 7,125,912 (GRCm38) missense probably damaging 0.99
IGL02305:Dync2h1 APN 9 7,122,678 (GRCm38) missense probably benign
IGL02342:Dync2h1 APN 9 7,142,246 (GRCm38) missense probably damaging 1.00
IGL02367:Dync2h1 APN 9 7,158,926 (GRCm38) missense probably damaging 0.98
IGL02458:Dync2h1 APN 9 7,117,422 (GRCm38) missense probably damaging 1.00
IGL02563:Dync2h1 APN 9 7,035,700 (GRCm38) missense possibly damaging 0.95
IGL02825:Dync2h1 APN 9 6,955,901 (GRCm38) splice site probably benign
IGL02955:Dync2h1 APN 9 7,142,864 (GRCm38) missense probably benign 0.00
IGL02992:Dync2h1 APN 9 7,137,074 (GRCm38) missense probably benign 0.01
IGL02996:Dync2h1 APN 9 6,935,279 (GRCm38) missense probably damaging 0.99
IGL03224:Dync2h1 APN 9 7,076,235 (GRCm38) missense probably benign 0.32
IGL03226:Dync2h1 APN 9 7,125,918 (GRCm38) missense probably benign
IGL03233:Dync2h1 APN 9 7,101,525 (GRCm38) missense possibly damaging 0.90
deinonychus UTSW 9 7,159,478 (GRCm38) splice site probably null
R0016:Dync2h1 UTSW 9 7,144,346 (GRCm38) splice site probably benign
R0016:Dync2h1 UTSW 9 7,144,346 (GRCm38) splice site probably benign
R0043:Dync2h1 UTSW 9 7,005,574 (GRCm38) missense probably benign 0.05
R0109:Dync2h1 UTSW 9 7,111,487 (GRCm38) missense probably damaging 1.00
R0109:Dync2h1 UTSW 9 7,111,487 (GRCm38) missense probably damaging 1.00
R0121:Dync2h1 UTSW 9 7,001,327 (GRCm38) splice site probably benign
R0277:Dync2h1 UTSW 9 7,129,046 (GRCm38) missense probably benign
R0360:Dync2h1 UTSW 9 7,113,182 (GRCm38) missense possibly damaging 0.62
R0362:Dync2h1 UTSW 9 7,005,487 (GRCm38) splice site probably null
R0389:Dync2h1 UTSW 9 7,167,244 (GRCm38) splice site probably null
R0443:Dync2h1 UTSW 9 7,167,244 (GRCm38) splice site probably null
R0496:Dync2h1 UTSW 9 7,155,180 (GRCm38) missense probably benign 0.42
R0506:Dync2h1 UTSW 9 7,113,153 (GRCm38) missense probably benign 0.05
R0511:Dync2h1 UTSW 9 7,122,692 (GRCm38) missense probably benign 0.00
R0540:Dync2h1 UTSW 9 7,051,480 (GRCm38) missense probably benign 0.00
R0550:Dync2h1 UTSW 9 7,120,954 (GRCm38) splice site probably null
R0564:Dync2h1 UTSW 9 7,139,432 (GRCm38) missense probably damaging 1.00
R0607:Dync2h1 UTSW 9 7,051,480 (GRCm38) missense probably benign 0.00
R0699:Dync2h1 UTSW 9 7,103,680 (GRCm38) missense probably benign 0.00
R0725:Dync2h1 UTSW 9 7,015,497 (GRCm38) missense possibly damaging 0.93
R0835:Dync2h1 UTSW 9 7,116,642 (GRCm38) critical splice acceptor site probably null
R0837:Dync2h1 UTSW 9 7,077,979 (GRCm38) missense probably benign 0.07
R0894:Dync2h1 UTSW 9 7,041,734 (GRCm38) splice site probably benign
R0938:Dync2h1 UTSW 9 7,002,658 (GRCm38) missense probably benign 0.02
R1056:Dync2h1 UTSW 9 7,147,731 (GRCm38) missense probably benign 0.15
R1081:Dync2h1 UTSW 9 7,005,488 (GRCm38) critical splice donor site probably null
R1178:Dync2h1 UTSW 9 7,101,193 (GRCm38) splice site probably benign
R1243:Dync2h1 UTSW 9 7,120,882 (GRCm38) missense probably benign
R1295:Dync2h1 UTSW 9 7,075,752 (GRCm38) splice site probably benign
R1304:Dync2h1 UTSW 9 7,102,318 (GRCm38) missense probably damaging 1.00
R1387:Dync2h1 UTSW 9 7,125,816 (GRCm38) missense probably benign
R1513:Dync2h1 UTSW 9 7,103,663 (GRCm38) missense possibly damaging 0.74
R1557:Dync2h1 UTSW 9 7,140,911 (GRCm38) missense probably damaging 1.00
R1568:Dync2h1 UTSW 9 7,157,553 (GRCm38) missense probably null 0.02
R1570:Dync2h1 UTSW 9 7,176,926 (GRCm38) missense probably benign 0.12
R1670:Dync2h1 UTSW 9 6,993,942 (GRCm38) missense possibly damaging 0.82
R1713:Dync2h1 UTSW 9 7,131,891 (GRCm38) missense probably benign
R1766:Dync2h1 UTSW 9 7,015,526 (GRCm38) critical splice acceptor site probably null
R1773:Dync2h1 UTSW 9 7,128,256 (GRCm38) missense probably damaging 1.00
R1786:Dync2h1 UTSW 9 7,081,084 (GRCm38) missense probably damaging 1.00
R1848:Dync2h1 UTSW 9 7,049,166 (GRCm38) missense probably benign 0.01
R1850:Dync2h1 UTSW 9 7,001,448 (GRCm38) missense probably benign 0.00
R1935:Dync2h1 UTSW 9 7,139,159 (GRCm38) critical splice donor site probably null
R1936:Dync2h1 UTSW 9 7,139,159 (GRCm38) critical splice donor site probably null
R1937:Dync2h1 UTSW 9 7,139,159 (GRCm38) critical splice donor site probably null
R1939:Dync2h1 UTSW 9 7,139,159 (GRCm38) critical splice donor site probably null
R1940:Dync2h1 UTSW 9 7,139,159 (GRCm38) critical splice donor site probably null
R1944:Dync2h1 UTSW 9 7,001,377 (GRCm38) missense probably damaging 1.00
R1976:Dync2h1 UTSW 9 7,129,045 (GRCm38) missense probably benign
R2012:Dync2h1 UTSW 9 7,169,589 (GRCm38) missense probably benign 0.00
R2020:Dync2h1 UTSW 9 7,162,925 (GRCm38) missense probably benign 0.25
R2020:Dync2h1 UTSW 9 7,122,772 (GRCm38) missense probably damaging 0.99
R2024:Dync2h1 UTSW 9 7,129,062 (GRCm38) missense probably damaging 0.97
R2038:Dync2h1 UTSW 9 6,967,226 (GRCm38) missense probably damaging 0.99
R2045:Dync2h1 UTSW 9 7,160,171 (GRCm38) missense probably damaging 1.00
R2060:Dync2h1 UTSW 9 7,162,802 (GRCm38) missense possibly damaging 0.92
R2094:Dync2h1 UTSW 9 7,148,735 (GRCm38) missense probably benign 0.18
R2129:Dync2h1 UTSW 9 7,175,289 (GRCm38) missense possibly damaging 0.94
R2130:Dync2h1 UTSW 9 7,011,253 (GRCm38) missense probably damaging 1.00
R2136:Dync2h1 UTSW 9 7,122,772 (GRCm38) missense probably damaging 0.99
R2164:Dync2h1 UTSW 9 7,124,797 (GRCm38) missense probably damaging 1.00
R2242:Dync2h1 UTSW 9 7,037,828 (GRCm38) splice site probably null
R2255:Dync2h1 UTSW 9 6,955,905 (GRCm38) critical splice donor site probably null
R2357:Dync2h1 UTSW 9 7,081,053 (GRCm38) missense probably benign 0.03
R2389:Dync2h1 UTSW 9 7,122,618 (GRCm38) missense possibly damaging 0.82
R2412:Dync2h1 UTSW 9 7,144,246 (GRCm38) missense probably benign 0.01
R2885:Dync2h1 UTSW 9 7,102,329 (GRCm38) missense probably damaging 1.00
R2909:Dync2h1 UTSW 9 7,049,114 (GRCm38) missense probably damaging 1.00
R3434:Dync2h1 UTSW 9 7,011,236 (GRCm38) missense probably benign
R3719:Dync2h1 UTSW 9 7,006,882 (GRCm38) splice site probably benign
R3723:Dync2h1 UTSW 9 7,041,658 (GRCm38) missense probably benign 0.17
R3800:Dync2h1 UTSW 9 7,101,525 (GRCm38) missense possibly damaging 0.90
R3803:Dync2h1 UTSW 9 6,935,293 (GRCm38) missense probably benign 0.00
R3936:Dync2h1 UTSW 9 7,001,482 (GRCm38) missense probably damaging 1.00
R3941:Dync2h1 UTSW 9 7,124,825 (GRCm38) missense probably benign
R3950:Dync2h1 UTSW 9 7,112,061 (GRCm38) nonsense probably null
R4004:Dync2h1 UTSW 9 7,117,404 (GRCm38) missense probably damaging 1.00
R4091:Dync2h1 UTSW 9 7,131,881 (GRCm38) missense probably benign 0.01
R4233:Dync2h1 UTSW 9 7,134,360 (GRCm38) missense probably benign 0.02
R4302:Dync2h1 UTSW 9 7,077,880 (GRCm38) missense probably benign 0.02
R4451:Dync2h1 UTSW 9 6,983,477 (GRCm38) missense probably benign 0.02
R4512:Dync2h1 UTSW 9 7,085,009 (GRCm38) nonsense probably null
R4596:Dync2h1 UTSW 9 6,992,595 (GRCm38) missense probably benign
R4604:Dync2h1 UTSW 9 7,140,995 (GRCm38) missense probably benign 0.00
R4614:Dync2h1 UTSW 9 7,011,290 (GRCm38) missense probably benign 0.03
R4667:Dync2h1 UTSW 9 7,051,411 (GRCm38) missense probably benign 0.00
R4671:Dync2h1 UTSW 9 7,169,640 (GRCm38) missense possibly damaging 0.82
R4714:Dync2h1 UTSW 9 7,118,932 (GRCm38) missense possibly damaging 0.86
R4716:Dync2h1 UTSW 9 7,142,648 (GRCm38) critical splice donor site probably null
R4736:Dync2h1 UTSW 9 7,006,862 (GRCm38) missense probably benign 0.00
R4807:Dync2h1 UTSW 9 7,139,422 (GRCm38) missense probably benign 0.31
R4850:Dync2h1 UTSW 9 7,134,364 (GRCm38) missense probably benign 0.14
R4862:Dync2h1 UTSW 9 7,147,717 (GRCm38) missense probably benign
R4899:Dync2h1 UTSW 9 7,131,921 (GRCm38) nonsense probably null
R4971:Dync2h1 UTSW 9 7,131,949 (GRCm38) missense probably benign
R5040:Dync2h1 UTSW 9 6,992,625 (GRCm38) missense probably benign 0.09
R5054:Dync2h1 UTSW 9 7,085,007 (GRCm38) missense possibly damaging 0.63
R5274:Dync2h1 UTSW 9 7,116,540 (GRCm38) missense probably benign 0.00
R5307:Dync2h1 UTSW 9 7,155,099 (GRCm38) missense probably damaging 1.00
R5347:Dync2h1 UTSW 9 7,129,727 (GRCm38) missense probably damaging 1.00
R5372:Dync2h1 UTSW 9 7,176,962 (GRCm38) unclassified probably benign
R5384:Dync2h1 UTSW 9 7,016,791 (GRCm38) missense probably damaging 0.99
R5385:Dync2h1 UTSW 9 7,016,791 (GRCm38) missense probably damaging 0.99
R5394:Dync2h1 UTSW 9 7,120,899 (GRCm38) nonsense probably null
R5402:Dync2h1 UTSW 9 7,114,949 (GRCm38) missense probably damaging 1.00
R5446:Dync2h1 UTSW 9 7,144,217 (GRCm38) missense probably benign
R5538:Dync2h1 UTSW 9 7,168,630 (GRCm38) intron probably benign
R5551:Dync2h1 UTSW 9 7,031,718 (GRCm38) missense possibly damaging 0.74
R5619:Dync2h1 UTSW 9 7,118,885 (GRCm38) missense probably benign 0.02
R5621:Dync2h1 UTSW 9 7,120,909 (GRCm38) missense possibly damaging 0.86
R5652:Dync2h1 UTSW 9 7,116,638 (GRCm38) missense probably benign 0.45
R5655:Dync2h1 UTSW 9 7,148,659 (GRCm38) missense probably benign 0.01
R5689:Dync2h1 UTSW 9 7,169,689 (GRCm38) missense probably damaging 1.00
R5725:Dync2h1 UTSW 9 7,169,528 (GRCm38) missense probably benign 0.21
R5742:Dync2h1 UTSW 9 7,165,762 (GRCm38) missense possibly damaging 0.64
R5817:Dync2h1 UTSW 9 6,996,905 (GRCm38) missense probably damaging 1.00
R5852:Dync2h1 UTSW 9 7,011,290 (GRCm38) missense probably benign 0.03
R5898:Dync2h1 UTSW 9 7,148,717 (GRCm38) missense probably benign 0.00
R5916:Dync2h1 UTSW 9 7,102,309 (GRCm38) critical splice donor site probably null
R5939:Dync2h1 UTSW 9 7,037,801 (GRCm38) missense probably damaging 0.99
R5942:Dync2h1 UTSW 9 7,117,466 (GRCm38) nonsense probably null
R5982:Dync2h1 UTSW 9 6,955,986 (GRCm38) missense probably benign 0.00
R6029:Dync2h1 UTSW 9 7,157,646 (GRCm38) missense probably benign
R6125:Dync2h1 UTSW 9 7,168,706 (GRCm38) missense probably damaging 1.00
R6209:Dync2h1 UTSW 9 7,165,677 (GRCm38) missense probably benign 0.01
R6247:Dync2h1 UTSW 9 7,135,078 (GRCm38) missense probably damaging 1.00
R6294:Dync2h1 UTSW 9 7,084,986 (GRCm38) missense probably benign 0.01
R6328:Dync2h1 UTSW 9 7,165,717 (GRCm38) missense probably benign 0.00
R6376:Dync2h1 UTSW 9 7,165,703 (GRCm38) missense probably benign 0.21
R6394:Dync2h1 UTSW 9 7,168,331 (GRCm38) missense probably damaging 0.99
R6539:Dync2h1 UTSW 9 7,159,478 (GRCm38) splice site probably null
R6554:Dync2h1 UTSW 9 7,037,699 (GRCm38) missense probably benign 0.39
R6559:Dync2h1 UTSW 9 7,139,501 (GRCm38) missense possibly damaging 0.72
R6563:Dync2h1 UTSW 9 7,120,819 (GRCm38) missense probably benign 0.27
R6848:Dync2h1 UTSW 9 7,159,632 (GRCm38) missense probably benign 0.22
R6901:Dync2h1 UTSW 9 7,131,855 (GRCm38) missense probably damaging 1.00
R6921:Dync2h1 UTSW 9 7,102,549 (GRCm38) missense probably benign
R6997:Dync2h1 UTSW 9 7,168,743 (GRCm38) missense probably null 0.00
R7084:Dync2h1 UTSW 9 7,113,214 (GRCm38) missense possibly damaging 0.72
R7113:Dync2h1 UTSW 9 7,075,788 (GRCm38) missense probably benign 0.03
R7131:Dync2h1 UTSW 9 7,075,786 (GRCm38) missense probably damaging 1.00
R7165:Dync2h1 UTSW 9 7,050,479 (GRCm38) missense probably benign
R7196:Dync2h1 UTSW 9 7,147,715 (GRCm38) nonsense probably null
R7208:Dync2h1 UTSW 9 7,141,059 (GRCm38) missense probably damaging 1.00
R7225:Dync2h1 UTSW 9 7,142,756 (GRCm38) missense probably benign
R7237:Dync2h1 UTSW 9 6,993,966 (GRCm38) missense probably benign 0.00
R7243:Dync2h1 UTSW 9 7,102,405 (GRCm38) missense possibly damaging 0.64
R7291:Dync2h1 UTSW 9 6,929,590 (GRCm38) missense possibly damaging 0.69
R7293:Dync2h1 UTSW 9 7,001,454 (GRCm38) missense possibly damaging 0.88
R7329:Dync2h1 UTSW 9 7,011,247 (GRCm38) missense probably benign
R7351:Dync2h1 UTSW 9 7,167,145 (GRCm38) missense probably damaging 1.00
R7358:Dync2h1 UTSW 9 7,159,479 (GRCm38) critical splice donor site probably null
R7387:Dync2h1 UTSW 9 7,157,932 (GRCm38) missense possibly damaging 0.68
R7446:Dync2h1 UTSW 9 7,041,720 (GRCm38) missense probably benign 0.03
R7487:Dync2h1 UTSW 9 7,132,041 (GRCm38) missense probably benign 0.26
R7488:Dync2h1 UTSW 9 7,124,855 (GRCm38) missense probably benign 0.03
R7496:Dync2h1 UTSW 9 7,135,015 (GRCm38) splice site probably null
R7501:Dync2h1 UTSW 9 7,175,336 (GRCm38) missense possibly damaging 0.82
R7571:Dync2h1 UTSW 9 7,002,623 (GRCm38) missense probably damaging 1.00
R7627:Dync2h1 UTSW 9 7,101,111 (GRCm38) missense probably benign 0.00
R7639:Dync2h1 UTSW 9 7,141,254 (GRCm38) missense probably damaging 0.97
R7653:Dync2h1 UTSW 9 7,117,570 (GRCm38) missense probably benign
R7654:Dync2h1 UTSW 9 7,122,664 (GRCm38) missense probably damaging 1.00
R7742:Dync2h1 UTSW 9 7,076,232 (GRCm38) missense probably benign 0.00
R7755:Dync2h1 UTSW 9 7,015,490 (GRCm38) missense probably benign 0.00
R7762:Dync2h1 UTSW 9 7,129,719 (GRCm38) missense probably benign 0.01
R7790:Dync2h1 UTSW 9 7,114,914 (GRCm38) missense probably damaging 0.96
R7834:Dync2h1 UTSW 9 7,118,953 (GRCm38) missense probably benign 0.04
R7883:Dync2h1 UTSW 9 7,005,566 (GRCm38) missense possibly damaging 0.80
R7952:Dync2h1 UTSW 9 7,129,802 (GRCm38) missense possibly damaging 0.63
R8111:Dync2h1 UTSW 9 7,148,688 (GRCm38) missense probably benign 0.03
R8157:Dync2h1 UTSW 9 7,001,473 (GRCm38) missense possibly damaging 0.47
R8166:Dync2h1 UTSW 9 7,129,089 (GRCm38) nonsense probably null
R8236:Dync2h1 UTSW 9 7,080,363 (GRCm38) intron probably benign
R8326:Dync2h1 UTSW 9 7,147,771 (GRCm38) missense probably benign
R8335:Dync2h1 UTSW 9 7,084,941 (GRCm38) missense probably benign 0.28
R8347:Dync2h1 UTSW 9 7,116,578 (GRCm38) missense possibly damaging 0.81
R8372:Dync2h1 UTSW 9 7,111,514 (GRCm38) missense possibly damaging 0.90
R8421:Dync2h1 UTSW 9 7,102,477 (GRCm38) missense probably damaging 1.00
R8518:Dync2h1 UTSW 9 7,051,452 (GRCm38) missense probably benign 0.04
R8556:Dync2h1 UTSW 9 7,113,198 (GRCm38) missense probably benign 0.32
R8690:Dync2h1 UTSW 9 7,075,824 (GRCm38) missense probably damaging 1.00
R8713:Dync2h1 UTSW 9 7,141,008 (GRCm38) nonsense probably null
R8719:Dync2h1 UTSW 9 7,041,641 (GRCm38) missense probably benign 0.05
R8732:Dync2h1 UTSW 9 7,168,326 (GRCm38) missense probably damaging 1.00
R8744:Dync2h1 UTSW 9 7,011,220 (GRCm38) nonsense probably null
R8749:Dync2h1 UTSW 9 7,035,063 (GRCm38) missense probably benign 0.32
R8795:Dync2h1 UTSW 9 7,137,087 (GRCm38) missense probably benign 0.00
R8853:Dync2h1 UTSW 9 7,117,645 (GRCm38) missense possibly damaging 0.94
R8923:Dync2h1 UTSW 9 7,168,515 (GRCm38) missense probably benign
R8969:Dync2h1 UTSW 9 7,130,723 (GRCm38) missense probably damaging 1.00
R8988:Dync2h1 UTSW 9 7,037,727 (GRCm38) missense probably benign 0.00
R8997:Dync2h1 UTSW 9 7,129,003 (GRCm38) missense probably benign
R9025:Dync2h1 UTSW 9 7,139,462 (GRCm38) nonsense probably null
R9036:Dync2h1 UTSW 9 7,051,495 (GRCm38) missense probably damaging 1.00
R9055:Dync2h1 UTSW 9 6,996,641 (GRCm38) intron probably benign
R9165:Dync2h1 UTSW 9 7,114,883 (GRCm38) missense probably damaging 0.99
R9172:Dync2h1 UTSW 9 7,031,771 (GRCm38) missense probably damaging 1.00
R9286:Dync2h1 UTSW 9 6,941,668 (GRCm38) missense probably benign 0.01
R9312:Dync2h1 UTSW 9 7,050,413 (GRCm38) missense probably damaging 1.00
R9335:Dync2h1 UTSW 9 7,112,149 (GRCm38) missense possibly damaging 0.88
R9344:Dync2h1 UTSW 9 7,148,659 (GRCm38) missense probably benign 0.01
R9351:Dync2h1 UTSW 9 7,176,911 (GRCm38) missense probably damaging 0.98
R9367:Dync2h1 UTSW 9 7,125,730 (GRCm38) critical splice donor site probably null
R9613:Dync2h1 UTSW 9 7,075,769 (GRCm38) missense probably damaging 0.99
R9650:Dync2h1 UTSW 9 7,174,849 (GRCm38) missense possibly damaging 0.83
R9726:Dync2h1 UTSW 9 7,077,999 (GRCm38) missense possibly damaging 0.94
R9731:Dync2h1 UTSW 9 7,141,166 (GRCm38) missense probably benign
X0009:Dync2h1 UTSW 9 7,117,576 (GRCm38) missense possibly damaging 0.81
Z1176:Dync2h1 UTSW 9 7,168,730 (GRCm38) frame shift probably null
Z1176:Dync2h1 UTSW 9 7,142,361 (GRCm38) missense probably damaging 0.99
Z1177:Dync2h1 UTSW 9 7,102,427 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTCTTACAAACTTGTGTCTGG -3'
(R):5'- CACTGGACTGGACACTTACGAG -3'

Sequencing Primer
(F):5'- ACAAACTTGTGTCTGGTTTCTTC -3'
(R):5'- GACTGGACACTTACGAGTTTTGAAG -3'
Posted On 2018-09-12