Incidental Mutation 'R6807:Lig3'
ID533615
Institutional Source Beutler Lab
Gene Symbol Lig3
Ensembl Gene ENSMUSG00000020697
Gene Nameligase III, DNA, ATP-dependent
SynonymsD11Wsu78e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6807 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location82781108-82804274 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82783751 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 134 (D134E)
Ref Sequence ENSEMBL: ENSMUSP00000079317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021039] [ENSMUST00000080461] [ENSMUST00000092849] [ENSMUST00000131537] [ENSMUST00000173009] [ENSMUST00000173347] [ENSMUST00000173722] [ENSMUST00000173727]
Predicted Effect probably benign
Transcript: ENSMUST00000021039
AA Change: D134E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021039
Gene: ENSMUSG00000020697
AA Change: D134E

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 265 440 3.5e-34 PFAM
Pfam:DNA_ligase_A_M 489 683 3.9e-65 PFAM
Pfam:DNA_ligase_A_C 710 820 3.8e-21 PFAM
low complexity region 855 885 N/A INTRINSIC
BRCT 942 1010 9.77e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080461
AA Change: D134E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000079317
Gene: ENSMUSG00000020697
AA Change: D134E

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 6.8e-53 PFAM
Pfam:DNA_ligase_A_M 485 679 1.3e-63 PFAM
Pfam:DNA_ligase_A_C 706 816 3.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
low complexity region 934 946 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092849
AA Change: D134E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000090525
Gene: ENSMUSG00000020697
AA Change: D134E

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 485 679 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 706 816 2.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
BRCT 938 1006 9.77e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131537
AA Change: D134E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133672
Gene: ENSMUSG00000020697
AA Change: D134E

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 431 3.1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173009
AA Change: D134E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133348
Gene: ENSMUSG00000020697
AA Change: D134E

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 431 3.1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173347
AA Change: D134E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134300
Gene: ENSMUSG00000020697
AA Change: D134E

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 262 436 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 484 678 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 705 815 2.2e-21 PFAM
low complexity region 850 880 N/A INTRINSIC
BRCT 937 1005 9.77e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173722
AA Change: D134E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133805
Gene: ENSMUSG00000020697
AA Change: D134E

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 485 679 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 706 816 2.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
BRCT 938 1006 9.77e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173727
AA Change: D134E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133849
Gene: ENSMUSG00000020697
AA Change: D134E

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 262 436 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 484 678 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 705 815 2.2e-21 PFAM
low complexity region 850 880 N/A INTRINSIC
BRCT 937 1005 9.77e-8 SMART
Meta Mutation Damage Score 0.0717 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.9%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DNA ligase family. Each member of this family encodes a protein that catalyzes the joining of DNA ends but they each have a distinct role in DNA metabolism. The protein encoded by this gene is involved in excision repair and is located in both the mitochondria and nucleus, with translation initiation from the upstream start codon allowing for transport to the mitochondria and translation initiation from a downstream start codon allowing for transport to the nucleus. Additionally, alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene causes embryonic growth arrest at 8.5 dpc, followed by excessive apoptosis at 9.5 dpc, and ultimately death, likely due to unrepaired DNA damage. Homozygous mutant cells display elevated sister chromatid exchange. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,391,530 T2158A probably benign Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Apol7a T C 15: 77,393,320 probably null Het
Bicdl1 C T 5: 115,672,143 probably null Het
Bop1 T A 15: 76,454,983 Q362L probably damaging Het
C4b T C 17: 34,730,956 D1418G probably benign Het
Cdh23 A G 10: 60,378,871 V1455A possibly damaging Het
Cecr2 T G 6: 120,734,542 probably null Het
Cer1 T C 4: 82,882,815 S204G probably benign Het
Cers3 G C 7: 66,764,220 W15C probably damaging Het
Csn1s2a A T 5: 87,781,872 H110L probably benign Het
Dnah10 T G 5: 124,790,000 probably null Het
Dync2h1 T C 9: 7,041,718 N3315S probably benign Het
Dynlrb2 T C 8: 116,507,560 M21T probably benign Het
Emilin1 T A 5: 30,915,527 F103I probably benign Het
Esrra T A 19: 6,911,774 M416L probably benign Het
Etaa1 C A 11: 17,952,680 V86L probably benign Het
Extl3 A G 14: 65,076,762 S324P probably damaging Het
Fam90a1a T C 8: 21,963,352 V241A probably benign Het
Fat4 C A 3: 38,982,440 Q3414K probably benign Het
Gm12166 T C 11: 46,052,032 Q88R probably damaging Het
Gm13101 A G 4: 143,965,011 S381P probably damaging Het
Gpr162 C T 6: 124,861,201 R162H probably damaging Het
Gpr21 T A 2: 37,517,962 Y173* probably null Het
Gprc6a G A 10: 51,626,745 Q341* probably null Het
Herc2 T A 7: 56,164,922 S2674R probably damaging Het
Hnrnpdl A T 5: 100,039,136 H9Q probably null Het
Hps1 A G 19: 42,770,778 V125A possibly damaging Het
Iba57 G T 11: 59,158,614 P243H probably damaging Het
Incenp G T 19: 9,877,756 A597E unknown Het
Kat6a T A 8: 22,940,368 M1913K unknown Het
Klb G A 5: 65,379,534 V736M probably damaging Het
Krt33a T A 11: 100,012,383 T278S possibly damaging Het
Krt73 T G 15: 101,796,407 E348A probably damaging Het
Limd2 T C 11: 106,158,945 T73A probably benign Het
Lrpprc A G 17: 84,749,103 S787P possibly damaging Het
Macf1 A G 4: 123,374,415 M6735T probably damaging Het
Mapkbp1 C A 2: 120,021,159 Q861K probably damaging Het
Mc4r T A 18: 66,859,856 N62I probably damaging Het
Metap1d G A 2: 71,511,514 V151I probably damaging Het
Nek2 T C 1: 191,822,617 V147A probably damaging Het
Nlrp1b A T 11: 71,217,704 W324R probably damaging Het
Nol4l G T 2: 153,483,826 S113* probably null Het
Oc90 T A 15: 65,889,614 D185V probably damaging Het
Olfr1025-ps1 A T 2: 85,918,038 T38S possibly damaging Het
Olfr1243 G A 2: 89,527,588 T274M probably damaging Het
Olfr150 A T 9: 39,737,618 K268* probably null Het
Olfr437 T C 6: 43,167,238 F60S probably damaging Het
Olfr470 T A 7: 107,845,590 T48S possibly damaging Het
Olfr56 G A 11: 49,134,978 R262K probably damaging Het
Pcdha8 A G 18: 36,994,348 T628A probably damaging Het
Pcsk5 A T 19: 17,572,622 probably null Het
Pdgfrb T C 18: 61,078,649 probably null Het
Pgm3 A T 9: 86,556,502 probably null Het
Pin1rt1 T A 2: 104,714,718 Y23F probably benign Het
Poli T A 18: 70,530,151 probably null Het
Pom121 C A 5: 135,381,124 probably benign Het
Ppp2r5c A G 12: 110,569,022 D407G possibly damaging Het
Rgs12 A G 5: 35,023,171 D116G probably null Het
Serpina3b A T 12: 104,132,992 E255D probably benign Het
Slc46a1 A G 11: 78,466,964 H281R probably damaging Het
Spata6 T C 4: 111,784,815 I294T probably benign Het
Srgap1 T A 10: 121,828,726 probably null Het
Stag1 C T 9: 100,944,850 R957C probably damaging Het
Stk35 G A 2: 129,801,653 E186K probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tenm4 G A 7: 96,895,271 V2165I probably damaging Het
Tmem53 T C 4: 117,268,331 S207P probably benign Het
Ugt2a3 A G 5: 87,336,758 F136L probably benign Het
Unc13d T C 11: 116,066,751 K795E probably damaging Het
Zbtb11 C A 16: 55,990,502 T341K probably benign Het
Other mutations in Lig3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Lig3 APN 11 82797315 missense possibly damaging 0.90
IGL01577:Lig3 APN 11 82783477 missense probably benign 0.00
IGL01643:Lig3 APN 11 82798292 missense probably damaging 1.00
IGL01712:Lig3 APN 11 82789541 splice site probably benign
IGL01724:Lig3 APN 11 82790622 missense possibly damaging 0.95
IGL01749:Lig3 APN 11 82789867 missense probably damaging 1.00
IGL01778:Lig3 APN 11 82794541 missense probably damaging 1.00
IGL02798:Lig3 APN 11 82795705 splice site probably benign
IGL03007:Lig3 APN 11 82789575 missense probably damaging 1.00
IGL03178:Lig3 APN 11 82789722 splice site probably benign
R0001:Lig3 UTSW 11 82790591 missense probably damaging 1.00
R0115:Lig3 UTSW 11 82793935 missense probably damaging 1.00
R0834:Lig3 UTSW 11 82798287 missense probably damaging 0.99
R1460:Lig3 UTSW 11 82795798 splice site probably benign
R1602:Lig3 UTSW 11 82792194 critical splice donor site probably null
R1969:Lig3 UTSW 11 82795718 missense probably benign 0.14
R1971:Lig3 UTSW 11 82795718 missense probably benign 0.14
R1997:Lig3 UTSW 11 82787666 missense probably benign 0.00
R3817:Lig3 UTSW 11 82796115 missense possibly damaging 0.75
R4083:Lig3 UTSW 11 82790494 missense probably benign 0.31
R4084:Lig3 UTSW 11 82795424 missense probably damaging 1.00
R4665:Lig3 UTSW 11 82800250 missense probably damaging 0.99
R4737:Lig3 UTSW 11 82787727 missense probably damaging 1.00
R5212:Lig3 UTSW 11 82787678 missense probably benign
R5274:Lig3 UTSW 11 82797292 splice site probably null
R6320:Lig3 UTSW 11 82794007 critical splice donor site probably null
R7103:Lig3 UTSW 11 82797312 missense probably benign 0.17
R7552:Lig3 UTSW 11 82788891 missense probably benign 0.00
R7646:Lig3 UTSW 11 82783478 missense probably benign 0.00
R7910:Lig3 UTSW 11 82797775 missense probably damaging 0.99
R7966:Lig3 UTSW 11 82790516 missense probably damaging 1.00
R8001:Lig3 UTSW 11 82792076 missense probably benign 0.18
R8436:Lig3 UTSW 11 82792044 missense possibly damaging 0.82
R8699:Lig3 UTSW 11 82794550 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGGGACTCTGTACTGGC -3'
(R):5'- CCCTGCAATGGAGGAAAATGTAC -3'

Sequencing Primer
(F):5'- GACTCTGTACTGGCCCCTGTG -3'
(R):5'- CAGGGCCTGGTGATACAACTTTC -3'
Posted On2018-09-12