Incidental Mutation 'R6807:Unc13d'
ID533619
Institutional Source Beutler Lab
Gene Symbol Unc13d
Ensembl Gene ENSMUSG00000057948
Gene Nameunc-13 homolog D (C. elegans)
Synonyms2610108D09Rik, Munc13-4, Jinx
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R6807 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116062095-116077961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116066751 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 795 (K795E)
Ref Sequence ENSEMBL: ENSMUSP00000102059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075036] [ENSMUST00000106450] [ENSMUST00000106451] [ENSMUST00000173345] [ENSMUST00000174822]
Predicted Effect probably damaging
Transcript: ENSMUST00000075036
AA Change: K793E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074549
Gene: ENSMUSG00000057948
AA Change: K793E

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106450
AA Change: K795E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102058
Gene: ENSMUSG00000057948
AA Change: K795E

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 787 894 1.9e-25 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106451
AA Change: K795E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102059
Gene: ENSMUSG00000057948
AA Change: K795E

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 788 838 7.1e-10 PFAM
Pfam:Membr_traf_MHD 830 893 1.4e-15 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173345
AA Change: K795E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133679
Gene: ENSMUSG00000057948
AA Change: K795E

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 5e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174822
AA Change: K793E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134260
Gene: ENSMUSG00000057948
AA Change: K793E

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Meta Mutation Damage Score 0.2460 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.9%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the UNC13 family, containing similar domain structure as other family members but lacking an N-terminal phorbol ester-binding C1 domain present in other Munc13 proteins. The protein appears to play a role in vesicle maturation during exocytosis and is involved in regulation of cytolytic granules secretion. Mutations in this gene are associated with familial hemophagocytic lymphohistiocytosis type 3, a genetically heterogeneous, rare autosomal recessive disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted deletion of this gene leads to defective hemostasis, abrogated thrombus formation and protection of homozygotes from ischemic stroke in the absence of intracranial bleeding. Homozygous ENU mutant mice are sensitive to infection by mouse cytomegalovirus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,391,530 T2158A probably benign Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Apol7a T C 15: 77,393,320 probably null Het
Bicdl1 C T 5: 115,672,143 probably null Het
Bop1 T A 15: 76,454,983 Q362L probably damaging Het
C4b T C 17: 34,730,956 D1418G probably benign Het
Cdh23 A G 10: 60,378,871 V1455A possibly damaging Het
Cecr2 T G 6: 120,734,542 probably null Het
Cer1 T C 4: 82,882,815 S204G probably benign Het
Cers3 G C 7: 66,764,220 W15C probably damaging Het
Csn1s2a A T 5: 87,781,872 H110L probably benign Het
Dnah10 T G 5: 124,790,000 probably null Het
Dync2h1 T C 9: 7,041,718 N3315S probably benign Het
Dynlrb2 T C 8: 116,507,560 M21T probably benign Het
Emilin1 T A 5: 30,915,527 F103I probably benign Het
Esrra T A 19: 6,911,774 M416L probably benign Het
Etaa1 C A 11: 17,952,680 V86L probably benign Het
Extl3 A G 14: 65,076,762 S324P probably damaging Het
Fam90a1a T C 8: 21,963,352 V241A probably benign Het
Fat4 C A 3: 38,982,440 Q3414K probably benign Het
Gm12166 T C 11: 46,052,032 Q88R probably damaging Het
Gm13101 A G 4: 143,965,011 S381P probably damaging Het
Gpr162 C T 6: 124,861,201 R162H probably damaging Het
Gpr21 T A 2: 37,517,962 Y173* probably null Het
Gprc6a G A 10: 51,626,745 Q341* probably null Het
Herc2 T A 7: 56,164,922 S2674R probably damaging Het
Hnrnpdl A T 5: 100,039,136 H9Q probably null Het
Hps1 A G 19: 42,770,778 V125A possibly damaging Het
Iba57 G T 11: 59,158,614 P243H probably damaging Het
Incenp G T 19: 9,877,756 A597E unknown Het
Kat6a T A 8: 22,940,368 M1913K unknown Het
Klb G A 5: 65,379,534 V736M probably damaging Het
Krt33a T A 11: 100,012,383 T278S possibly damaging Het
Krt73 T G 15: 101,796,407 E348A probably damaging Het
Lig3 T A 11: 82,783,751 D134E probably benign Het
Limd2 T C 11: 106,158,945 T73A probably benign Het
Lrpprc A G 17: 84,749,103 S787P possibly damaging Het
Macf1 A G 4: 123,374,415 M6735T probably damaging Het
Mapkbp1 C A 2: 120,021,159 Q861K probably damaging Het
Mc4r T A 18: 66,859,856 N62I probably damaging Het
Metap1d G A 2: 71,511,514 V151I probably damaging Het
Nek2 T C 1: 191,822,617 V147A probably damaging Het
Nlrp1b A T 11: 71,217,704 W324R probably damaging Het
Nol4l G T 2: 153,483,826 S113* probably null Het
Oc90 T A 15: 65,889,614 D185V probably damaging Het
Olfr1025-ps1 A T 2: 85,918,038 T38S possibly damaging Het
Olfr1243 G A 2: 89,527,588 T274M probably damaging Het
Olfr150 A T 9: 39,737,618 K268* probably null Het
Olfr437 T C 6: 43,167,238 F60S probably damaging Het
Olfr470 T A 7: 107,845,590 T48S possibly damaging Het
Olfr56 G A 11: 49,134,978 R262K probably damaging Het
Pcdha8 A G 18: 36,994,348 T628A probably damaging Het
Pcsk5 A T 19: 17,572,622 probably null Het
Pdgfrb T C 18: 61,078,649 probably null Het
Pgm3 A T 9: 86,556,502 probably null Het
Pin1rt1 T A 2: 104,714,718 Y23F probably benign Het
Poli T A 18: 70,530,151 probably null Het
Pom121 C A 5: 135,381,124 probably benign Het
Ppp2r5c A G 12: 110,569,022 D407G possibly damaging Het
Rgs12 A G 5: 35,023,171 D116G probably null Het
Serpina3b A T 12: 104,132,992 E255D probably benign Het
Slc46a1 A G 11: 78,466,964 H281R probably damaging Het
Spata6 T C 4: 111,784,815 I294T probably benign Het
Srgap1 T A 10: 121,828,726 probably null Het
Stag1 C T 9: 100,944,850 R957C probably damaging Het
Stk35 G A 2: 129,801,653 E186K probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tenm4 G A 7: 96,895,271 V2165I probably damaging Het
Tmem53 T C 4: 117,268,331 S207P probably benign Het
Ugt2a3 A G 5: 87,336,758 F136L probably benign Het
Zbtb11 C A 16: 55,990,502 T341K probably benign Het
Other mutations in Unc13d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Unc13d APN 11 116074403 missense probably damaging 0.99
IGL00976:Unc13d APN 11 116070467 missense probably damaging 1.00
IGL01630:Unc13d APN 11 116073866 missense probably benign 0.00
IGL01761:Unc13d APN 11 116073869 missense probably damaging 1.00
IGL01772:Unc13d APN 11 116076532 missense possibly damaging 0.91
IGL01935:Unc13d APN 11 116069751 missense probably benign
IGL02486:Unc13d APN 11 116069806 splice site probably benign
IGL02503:Unc13d APN 11 116068802 missense possibly damaging 0.82
IGL02519:Unc13d APN 11 116070533 missense probably damaging 1.00
IGL02524:Unc13d APN 11 116070319 missense probably damaging 1.00
IGL02634:Unc13d APN 11 116070556 splice site probably benign
IGL02636:Unc13d APN 11 116073618 missense probably damaging 1.00
IGL03243:Unc13d APN 11 116067844 missense probably benign 0.34
jinx UTSW 11 116073423 unclassified probably benign
R0033:Unc13d UTSW 11 116069165 missense probably benign 0.00
R0084:Unc13d UTSW 11 116063831 missense probably damaging 1.00
R0122:Unc13d UTSW 11 116065482 missense probably benign 0.00
R0422:Unc13d UTSW 11 116070020 critical splice donor site probably null
R0666:Unc13d UTSW 11 116069492 splice site probably benign
R1019:Unc13d UTSW 11 116068074 missense probably benign 0.03
R1333:Unc13d UTSW 11 116073555 splice site probably benign
R1484:Unc13d UTSW 11 116073875 missense possibly damaging 0.72
R1594:Unc13d UTSW 11 116068712 missense probably benign 0.04
R1597:Unc13d UTSW 11 116074436 missense probably benign 0.02
R1603:Unc13d UTSW 11 116073655 missense possibly damaging 0.86
R1662:Unc13d UTSW 11 116068673 missense probably null 1.00
R1909:Unc13d UTSW 11 116070295 missense probably damaging 0.99
R2015:Unc13d UTSW 11 116068755 missense probably damaging 1.00
R2313:Unc13d UTSW 11 116063734 missense probably damaging 1.00
R2435:Unc13d UTSW 11 116068688 missense probably damaging 1.00
R4705:Unc13d UTSW 11 116073388 missense possibly damaging 0.70
R4732:Unc13d UTSW 11 116073582 missense possibly damaging 0.91
R4733:Unc13d UTSW 11 116073582 missense possibly damaging 0.91
R4792:Unc13d UTSW 11 116070282 missense probably damaging 1.00
R4843:Unc13d UTSW 11 116074259 missense probably damaging 1.00
R5496:Unc13d UTSW 11 116066708 missense probably damaging 1.00
R5571:Unc13d UTSW 11 116063654 missense probably benign 0.00
R5589:Unc13d UTSW 11 116069753 missense probably damaging 0.99
R5838:Unc13d UTSW 11 116064625 missense possibly damaging 0.80
R6058:Unc13d UTSW 11 116073568 critical splice donor site probably null
R6266:Unc13d UTSW 11 116068238 missense probably damaging 1.00
R7085:Unc13d UTSW 11 116064807 missense probably benign 0.07
R7098:Unc13d UTSW 11 116063726 missense probably damaging 1.00
R7269:Unc13d UTSW 11 116068230 missense probably benign 0.01
R7291:Unc13d UTSW 11 116074050 missense possibly damaging 0.79
R7453:Unc13d UTSW 11 116067871 missense probably benign
R7486:Unc13d UTSW 11 116074433 missense possibly damaging 0.68
R7618:Unc13d UTSW 11 116066721 missense probably damaging 1.00
R7817:Unc13d UTSW 11 116076283 missense probably damaging 1.00
R7952:Unc13d UTSW 11 116064941 intron probably null
X0027:Unc13d UTSW 11 116069756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTAGAGCTGGGCAGAAG -3'
(R):5'- CACAAAAGCTAGCTTTGTTCCC -3'

Sequencing Primer
(F):5'- GAAGCTGGTTACATCCTCCAAGG -3'
(R):5'- ACAAAAGCTAGCTTTGTTCCCTTACC -3'
Posted On2018-09-12