Incidental Mutation 'R6807:Ppp2r5c'
ID533621
Institutional Source Beutler Lab
Gene Symbol Ppp2r5c
Ensembl Gene ENSMUSG00000017843
Gene Nameprotein phosphatase 2, regulatory subunit B', gamma
Synonyms2700063L20Rik, 2610043M05Rik, Band 8A, D12Bwg0916e, B56/PP2A gamma
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6807 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location110447120-110583062 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110569022 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 407 (D407G)
Ref Sequence ENSEMBL: ENSMUSP00000152282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084985] [ENSMUST00000109832] [ENSMUST00000221074] [ENSMUST00000221715]
Predicted Effect probably benign
Transcript: ENSMUST00000084985
AA Change: D407G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000082053
Gene: ENSMUSG00000017843
AA Change: D407G

DomainStartEndE-ValueType
Pfam:B56 27 437 1.6e-199 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109832
AA Change: D407G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105458
Gene: ENSMUSG00000017843
AA Change: D407G

DomainStartEndE-ValueType
Pfam:B56 26 438 3e-178 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000221074
AA Change: D407G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000221715
AA Change: D407G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.1927 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.9%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele show partial neonatal lethality, hypoactivity, and abnormal ventricular septum formation associated with increased fetal cardiomyocyte apoptosis. Surviving homozygotes develop obesity and show an abnormal gait, decreased grip strength, and impaired balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,391,530 T2158A probably benign Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Apol7a T C 15: 77,393,320 probably null Het
Bicdl1 C T 5: 115,672,143 probably null Het
Bop1 T A 15: 76,454,983 Q362L probably damaging Het
C4b T C 17: 34,730,956 D1418G probably benign Het
Cdh23 A G 10: 60,378,871 V1455A possibly damaging Het
Cecr2 T G 6: 120,734,542 probably null Het
Cer1 T C 4: 82,882,815 S204G probably benign Het
Cers3 G C 7: 66,764,220 W15C probably damaging Het
Csn1s2a A T 5: 87,781,872 H110L probably benign Het
Dnah10 T G 5: 124,790,000 probably null Het
Dync2h1 T C 9: 7,041,718 N3315S probably benign Het
Dynlrb2 T C 8: 116,507,560 M21T probably benign Het
Emilin1 T A 5: 30,915,527 F103I probably benign Het
Esrra T A 19: 6,911,774 M416L probably benign Het
Etaa1 C A 11: 17,952,680 V86L probably benign Het
Extl3 A G 14: 65,076,762 S324P probably damaging Het
Fam90a1a T C 8: 21,963,352 V241A probably benign Het
Fat4 C A 3: 38,982,440 Q3414K probably benign Het
Gm12166 T C 11: 46,052,032 Q88R probably damaging Het
Gm13101 A G 4: 143,965,011 S381P probably damaging Het
Gpr162 C T 6: 124,861,201 R162H probably damaging Het
Gpr21 T A 2: 37,517,962 Y173* probably null Het
Gprc6a G A 10: 51,626,745 Q341* probably null Het
Herc2 T A 7: 56,164,922 S2674R probably damaging Het
Hnrnpdl A T 5: 100,039,136 H9Q probably null Het
Hps1 A G 19: 42,770,778 V125A possibly damaging Het
Iba57 G T 11: 59,158,614 P243H probably damaging Het
Incenp G T 19: 9,877,756 A597E unknown Het
Kat6a T A 8: 22,940,368 M1913K unknown Het
Klb G A 5: 65,379,534 V736M probably damaging Het
Krt33a T A 11: 100,012,383 T278S possibly damaging Het
Krt73 T G 15: 101,796,407 E348A probably damaging Het
Lig3 T A 11: 82,783,751 D134E probably benign Het
Limd2 T C 11: 106,158,945 T73A probably benign Het
Lrpprc A G 17: 84,749,103 S787P possibly damaging Het
Macf1 A G 4: 123,374,415 M6735T probably damaging Het
Mapkbp1 C A 2: 120,021,159 Q861K probably damaging Het
Mc4r T A 18: 66,859,856 N62I probably damaging Het
Metap1d G A 2: 71,511,514 V151I probably damaging Het
Nek2 T C 1: 191,822,617 V147A probably damaging Het
Nlrp1b A T 11: 71,217,704 W324R probably damaging Het
Nol4l G T 2: 153,483,826 S113* probably null Het
Oc90 T A 15: 65,889,614 D185V probably damaging Het
Olfr1025-ps1 A T 2: 85,918,038 T38S possibly damaging Het
Olfr1243 G A 2: 89,527,588 T274M probably damaging Het
Olfr150 A T 9: 39,737,618 K268* probably null Het
Olfr437 T C 6: 43,167,238 F60S probably damaging Het
Olfr470 T A 7: 107,845,590 T48S possibly damaging Het
Olfr56 G A 11: 49,134,978 R262K probably damaging Het
Pcdha8 A G 18: 36,994,348 T628A probably damaging Het
Pcsk5 A T 19: 17,572,622 probably null Het
Pdgfrb T C 18: 61,078,649 probably null Het
Pgm3 A T 9: 86,556,502 probably null Het
Pin1rt1 T A 2: 104,714,718 Y23F probably benign Het
Poli T A 18: 70,530,151 probably null Het
Pom121 C A 5: 135,381,124 probably benign Het
Rgs12 A G 5: 35,023,171 D116G probably null Het
Serpina3b A T 12: 104,132,992 E255D probably benign Het
Slc46a1 A G 11: 78,466,964 H281R probably damaging Het
Spata6 T C 4: 111,784,815 I294T probably benign Het
Srgap1 T A 10: 121,828,726 probably null Het
Stag1 C T 9: 100,944,850 R957C probably damaging Het
Stk35 G A 2: 129,801,653 E186K probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tenm4 G A 7: 96,895,271 V2165I probably damaging Het
Tmem53 T C 4: 117,268,331 S207P probably benign Het
Ugt2a3 A G 5: 87,336,758 F136L probably benign Het
Unc13d T C 11: 116,066,751 K795E probably damaging Het
Zbtb11 C A 16: 55,990,502 T341K probably benign Het
Other mutations in Ppp2r5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Ppp2r5c APN 12 110567827 missense probably benign 0.09
IGL01743:Ppp2r5c APN 12 110580434 missense probably benign 0.00
IGL01866:Ppp2r5c APN 12 110567827 missense probably benign 0.24
IGL02883:Ppp2r5c APN 12 110522563 missense possibly damaging 0.48
IGL02944:Ppp2r5c APN 12 110567800 missense probably benign 0.02
Abscond UTSW 12 110544077 missense probably benign 0.02
Cranraisin UTSW 12 110544145 missense probably damaging 1.00
elope UTSW 12 110561472 splice site probably benign
FR4976:Ppp2r5c UTSW 12 110540738 splice site probably null
R0020:Ppp2r5c UTSW 12 110574823 nonsense probably null
R0069:Ppp2r5c UTSW 12 110567770 missense probably benign 0.01
R0069:Ppp2r5c UTSW 12 110567770 missense probably benign 0.01
R0456:Ppp2r5c UTSW 12 110522579 missense probably damaging 0.99
R1521:Ppp2r5c UTSW 12 110554886 missense probably damaging 1.00
R1697:Ppp2r5c UTSW 12 110545623 nonsense probably null
R1697:Ppp2r5c UTSW 12 110561472 splice site probably benign
R2248:Ppp2r5c UTSW 12 110485923 missense probably benign 0.00
R3817:Ppp2r5c UTSW 12 110544187 critical splice donor site probably null
R4491:Ppp2r5c UTSW 12 110580522 missense possibly damaging 0.69
R5575:Ppp2r5c UTSW 12 110552832 missense probably damaging 1.00
R5828:Ppp2r5c UTSW 12 110570700 missense probably benign 0.01
R6059:Ppp2r5c UTSW 12 110574788 missense probably benign
R6351:Ppp2r5c UTSW 12 110554879 missense probably damaging 1.00
R6976:Ppp2r5c UTSW 12 110544145 missense probably damaging 1.00
R7236:Ppp2r5c UTSW 12 110465889 missense probably benign 0.01
R7360:Ppp2r5c UTSW 12 110574838 missense probably benign
R7363:Ppp2r5c UTSW 12 110522607 missense probably benign 0.01
R7467:Ppp2r5c UTSW 12 110552883 missense probably damaging 1.00
R7948:Ppp2r5c UTSW 12 110465986 missense probably benign
R8117:Ppp2r5c UTSW 12 110551085 missense possibly damaging 0.47
R8310:Ppp2r5c UTSW 12 110545825 missense possibly damaging 0.95
R8352:Ppp2r5c UTSW 12 110544077 missense probably benign 0.02
R8452:Ppp2r5c UTSW 12 110544077 missense probably benign 0.02
R8692:Ppp2r5c UTSW 12 110522598 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAACTTGTATTAGAGCCAAGTG -3'
(R):5'- GGCTTCAGACACATGCCTTTTG -3'

Sequencing Primer
(F):5'- AGAGCCAAGTGAGCTTATTGTG -3'
(R):5'- CAGACACATGCCTTTTGGTGACG -3'
Posted On2018-09-12