Incidental Mutation 'R6807:Mc4r'
ID533632
Institutional Source Beutler Lab
Gene Symbol Mc4r
Ensembl Gene ENSMUSG00000047259
Gene Namemelanocortin 4 receptor
SynonymsFatboy
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R6807 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location66857715-66860472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66859856 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 62 (N62I)
Ref Sequence ENSEMBL: ENSMUSP00000054776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057942]
Predicted Effect probably damaging
Transcript: ENSMUST00000057942
AA Change: N62I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054776
Gene: ENSMUSG00000047259
AA Change: N62I

DomainStartEndE-ValueType
Pfam:7tm_4 51 228 8.1e-11 PFAM
Pfam:7TM_GPCR_Srsx 55 317 6e-12 PFAM
Pfam:7tm_1 61 302 2.7e-31 PFAM
Meta Mutation Damage Score 0.9462 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.9%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: This gene encodes a member of the melanocortin receptor family. Melanocortin receptors are transmembrane G-protein coupled receptors, which respond to small peptide hormones and exhibit diverse functions and tissue type localization. As part of the central nervous melanocortin system, the encoded protein is competitively bound by either melanocyte stimulating hormone or agouti-related protein to regulate energy homeostasis. Disruption of this gene promotes hyperphagia and obesity, and is associated with increased cholesterol levels and insulin resistance. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mutations in this gene result in hyperglycemia and weight gain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,391,530 T2158A probably benign Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Apol7a T C 15: 77,393,320 probably null Het
Bicdl1 C T 5: 115,672,143 probably null Het
Bop1 T A 15: 76,454,983 Q362L probably damaging Het
C4b T C 17: 34,730,956 D1418G probably benign Het
Cdh23 A G 10: 60,378,871 V1455A possibly damaging Het
Cecr2 T G 6: 120,734,542 probably null Het
Cer1 T C 4: 82,882,815 S204G probably benign Het
Cers3 G C 7: 66,764,220 W15C probably damaging Het
Csn1s2a A T 5: 87,781,872 H110L probably benign Het
Dnah10 T G 5: 124,790,000 probably null Het
Dync2h1 T C 9: 7,041,718 N3315S probably benign Het
Dynlrb2 T C 8: 116,507,560 M21T probably benign Het
Emilin1 T A 5: 30,915,527 F103I probably benign Het
Esrra T A 19: 6,911,774 M416L probably benign Het
Etaa1 C A 11: 17,952,680 V86L probably benign Het
Extl3 A G 14: 65,076,762 S324P probably damaging Het
Fam90a1a T C 8: 21,963,352 V241A probably benign Het
Fat4 C A 3: 38,982,440 Q3414K probably benign Het
Gm12166 T C 11: 46,052,032 Q88R probably damaging Het
Gm13101 A G 4: 143,965,011 S381P probably damaging Het
Gpr162 C T 6: 124,861,201 R162H probably damaging Het
Gpr21 T A 2: 37,517,962 Y173* probably null Het
Gprc6a G A 10: 51,626,745 Q341* probably null Het
Herc2 T A 7: 56,164,922 S2674R probably damaging Het
Hnrnpdl A T 5: 100,039,136 H9Q probably null Het
Hps1 A G 19: 42,770,778 V125A possibly damaging Het
Iba57 G T 11: 59,158,614 P243H probably damaging Het
Incenp G T 19: 9,877,756 A597E unknown Het
Kat6a T A 8: 22,940,368 M1913K unknown Het
Klb G A 5: 65,379,534 V736M probably damaging Het
Krt33a T A 11: 100,012,383 T278S possibly damaging Het
Krt73 T G 15: 101,796,407 E348A probably damaging Het
Lig3 T A 11: 82,783,751 D134E probably benign Het
Limd2 T C 11: 106,158,945 T73A probably benign Het
Lrpprc A G 17: 84,749,103 S787P possibly damaging Het
Macf1 A G 4: 123,374,415 M6735T probably damaging Het
Mapkbp1 C A 2: 120,021,159 Q861K probably damaging Het
Metap1d G A 2: 71,511,514 V151I probably damaging Het
Nek2 T C 1: 191,822,617 V147A probably damaging Het
Nlrp1b A T 11: 71,217,704 W324R probably damaging Het
Nol4l G T 2: 153,483,826 S113* probably null Het
Oc90 T A 15: 65,889,614 D185V probably damaging Het
Olfr1025-ps1 A T 2: 85,918,038 T38S possibly damaging Het
Olfr1243 G A 2: 89,527,588 T274M probably damaging Het
Olfr150 A T 9: 39,737,618 K268* probably null Het
Olfr437 T C 6: 43,167,238 F60S probably damaging Het
Olfr470 T A 7: 107,845,590 T48S possibly damaging Het
Olfr56 G A 11: 49,134,978 R262K probably damaging Het
Pcdha8 A G 18: 36,994,348 T628A probably damaging Het
Pcsk5 A T 19: 17,572,622 probably null Het
Pdgfrb T C 18: 61,078,649 probably null Het
Pgm3 A T 9: 86,556,502 probably null Het
Pin1rt1 T A 2: 104,714,718 Y23F probably benign Het
Poli T A 18: 70,530,151 probably null Het
Pom121 C A 5: 135,381,124 probably benign Het
Ppp2r5c A G 12: 110,569,022 D407G possibly damaging Het
Rgs12 A G 5: 35,023,171 D116G probably null Het
Serpina3b A T 12: 104,132,992 E255D probably benign Het
Slc46a1 A G 11: 78,466,964 H281R probably damaging Het
Spata6 T C 4: 111,784,815 I294T probably benign Het
Srgap1 T A 10: 121,828,726 probably null Het
Stag1 C T 9: 100,944,850 R957C probably damaging Het
Stk35 G A 2: 129,801,653 E186K probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tenm4 G A 7: 96,895,271 V2165I probably damaging Het
Tmem53 T C 4: 117,268,331 S207P probably benign Het
Ugt2a3 A G 5: 87,336,758 F136L probably benign Het
Unc13d T C 11: 116,066,751 K795E probably damaging Het
Zbtb11 C A 16: 55,990,502 T341K probably benign Het
Other mutations in Mc4r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Mc4r APN 18 66859158 missense probably benign 0.01
IGL01382:Mc4r APN 18 66859793 missense probably damaging 0.96
IGL01820:Mc4r APN 18 66859155 missense probably benign 0.00
IGL02749:Mc4r APN 18 66859662 missense probably damaging 1.00
IGL02812:Mc4r APN 18 66859247 missense probably damaging 1.00
IGL03403:Mc4r APN 18 66859526 missense possibly damaging 0.61
Big_boned UTSW 18 66859488 missense probably damaging 1.00
Big_mac UTSW 18 66859856 missense probably damaging 1.00
blubbery UTSW 18 66859182 missense probably damaging 1.00
Cetacean UTSW 18 66859180 nonsense probably null
chubby UTSW 18 66859847 missense probably damaging 1.00
halloween UTSW 18 66859821 missense probably damaging 1.00
southbeach UTSW 18 66859142 missense probably damaging 1.00
R1552:Mc4r UTSW 18 66859695 missense probably benign 0.00
R1623:Mc4r UTSW 18 66859997 missense probably benign 0.03
R1666:Mc4r UTSW 18 66859409 missense probably damaging 1.00
R1668:Mc4r UTSW 18 66859409 missense probably damaging 1.00
R1781:Mc4r UTSW 18 66859847 missense probably damaging 1.00
R1873:Mc4r UTSW 18 66859460 missense probably damaging 1.00
R2105:Mc4r UTSW 18 66859598 missense probably damaging 1.00
R2210:Mc4r UTSW 18 66859395 missense probably damaging 1.00
R3714:Mc4r UTSW 18 66859821 missense probably damaging 1.00
R3715:Mc4r UTSW 18 66859821 missense probably damaging 1.00
R4115:Mc4r UTSW 18 66859979 missense probably benign
R4322:Mc4r UTSW 18 66859050 missense probably benign 0.00
R4492:Mc4r UTSW 18 66859640 missense probably benign 0.00
R4806:Mc4r UTSW 18 66859488 missense probably damaging 1.00
R4877:Mc4r UTSW 18 66859338 missense probably benign 0.00
R6161:Mc4r UTSW 18 66859180 nonsense probably null
R6802:Mc4r UTSW 18 66859417 missense probably benign 0.21
R6929:Mc4r UTSW 18 66859182 missense probably damaging 1.00
R7623:Mc4r UTSW 18 66859509 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TGTTCACGGTGAAGCTCTGG -3'
(R):5'- TCAGTTCAAGGAGGACTCAAATC -3'

Sequencing Primer
(F):5'- TGAAGCTCTGGGCATCCGTATC -3'
(R):5'- GAGGACTCAAATCCAGCTGCTG -3'
Posted On2018-09-12