Incidental Mutation 'R6807:Esrra'
ID533634
Institutional Source Beutler Lab
Gene Symbol Esrra
Ensembl Gene ENSMUSG00000024955
Gene Nameestrogen related receptor, alpha
SynonymsERRalpha, Err1, Estrra, Nr3b1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6807 (G1)
Quality Score159.009
Status Validated
Chromosome19
Chromosomal Location6910977-6921813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6911774 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 416 (M416L)
Ref Sequence ENSEMBL: ENSMUSP00000025906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025904] [ENSMUST00000025906] [ENSMUST00000088257] [ENSMUST00000116551] [ENSMUST00000149261] [ENSMUST00000173091] [ENSMUST00000173635] [ENSMUST00000174786]
Predicted Effect probably benign
Transcript: ENSMUST00000025904
SMART Domains Protein: ENSMUSP00000025904
Gene: ENSMUSG00000024953

DomainStartEndE-ValueType
Pfam:Redoxin 53 206 1e-31 PFAM
Pfam:AhpC-TSA 54 189 8.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025906
AA Change: M416L

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000025906
Gene: ENSMUSG00000024955
AA Change: M416L

DomainStartEndE-ValueType
internal_repeat_1 5 21 6.74e-5 PROSPERO
low complexity region 52 67 N/A INTRINSIC
ZnF_C4 76 147 2.16e-40 SMART
low complexity region 169 187 N/A INTRINSIC
internal_repeat_1 202 218 6.74e-5 PROSPERO
HOLI 229 391 9.21e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088257
SMART Domains Protein: ENSMUSP00000085591
Gene: ENSMUSG00000038812

DomainStartEndE-ValueType
Pfam:Trm112p 2 112 1.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116551
SMART Domains Protein: ENSMUSP00000112250
Gene: ENSMUSG00000038812

DomainStartEndE-ValueType
Pfam:Trm112p 2 112 1.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149261
SMART Domains Protein: ENSMUSP00000135084
Gene: ENSMUSG00000024953

DomainStartEndE-ValueType
Pfam:Redoxin 56 210 1.1e-31 PFAM
Pfam:AhpC-TSA 57 192 6.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173091
SMART Domains Protein: ENSMUSP00000134521
Gene: ENSMUSG00000024953

DomainStartEndE-ValueType
Pfam:Redoxin 53 99 3.3e-11 PFAM
Pfam:AhpC-TSA 54 100 9.3e-8 PFAM
Pfam:Redoxin 97 163 1.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173635
SMART Domains Protein: ENSMUSP00000134587
Gene: ENSMUSG00000024955

DomainStartEndE-ValueType
PDB:1LO1|A 1 21 6e-7 PDB
low complexity region 26 44 N/A INTRINSIC
Pfam:Hormone_recep 65 158 4.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174786
SMART Domains Protein: ENSMUSP00000134000
Gene: ENSMUSG00000038812

DomainStartEndE-ValueType
Pfam:Trm112p 2 101 5.6e-11 PFAM
Meta Mutation Damage Score 0.3223 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.9%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Homozygous mice for one mutation were viable but showed reduced weight gain associated with decreased peripheral fat deposition. Mutant mice were resistant to high-fat diet induced obesity. Another targeted mutation resulted in no significant abnormalities in homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,391,530 T2158A probably benign Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Apol7a T C 15: 77,393,320 probably null Het
Bicdl1 C T 5: 115,672,143 probably null Het
Bop1 T A 15: 76,454,983 Q362L probably damaging Het
C4b T C 17: 34,730,956 D1418G probably benign Het
Cdh23 A G 10: 60,378,871 V1455A possibly damaging Het
Cecr2 T G 6: 120,734,542 probably null Het
Cer1 T C 4: 82,882,815 S204G probably benign Het
Cers3 G C 7: 66,764,220 W15C probably damaging Het
Csn1s2a A T 5: 87,781,872 H110L probably benign Het
Dnah10 T G 5: 124,790,000 probably null Het
Dync2h1 T C 9: 7,041,718 N3315S probably benign Het
Dynlrb2 T C 8: 116,507,560 M21T probably benign Het
Emilin1 T A 5: 30,915,527 F103I probably benign Het
Etaa1 C A 11: 17,952,680 V86L probably benign Het
Extl3 A G 14: 65,076,762 S324P probably damaging Het
Fam90a1a T C 8: 21,963,352 V241A probably benign Het
Fat4 C A 3: 38,982,440 Q3414K probably benign Het
Gm12166 T C 11: 46,052,032 Q88R probably damaging Het
Gm13101 A G 4: 143,965,011 S381P probably damaging Het
Gpr162 C T 6: 124,861,201 R162H probably damaging Het
Gpr21 T A 2: 37,517,962 Y173* probably null Het
Gprc6a G A 10: 51,626,745 Q341* probably null Het
Herc2 T A 7: 56,164,922 S2674R probably damaging Het
Hnrnpdl A T 5: 100,039,136 H9Q probably null Het
Hps1 A G 19: 42,770,778 V125A possibly damaging Het
Iba57 G T 11: 59,158,614 P243H probably damaging Het
Incenp G T 19: 9,877,756 A597E unknown Het
Kat6a T A 8: 22,940,368 M1913K unknown Het
Klb G A 5: 65,379,534 V736M probably damaging Het
Krt33a T A 11: 100,012,383 T278S possibly damaging Het
Krt73 T G 15: 101,796,407 E348A probably damaging Het
Lig3 T A 11: 82,783,751 D134E probably benign Het
Limd2 T C 11: 106,158,945 T73A probably benign Het
Lrpprc A G 17: 84,749,103 S787P possibly damaging Het
Macf1 A G 4: 123,374,415 M6735T probably damaging Het
Mapkbp1 C A 2: 120,021,159 Q861K probably damaging Het
Mc4r T A 18: 66,859,856 N62I probably damaging Het
Metap1d G A 2: 71,511,514 V151I probably damaging Het
Nek2 T C 1: 191,822,617 V147A probably damaging Het
Nlrp1b A T 11: 71,217,704 W324R probably damaging Het
Nol4l G T 2: 153,483,826 S113* probably null Het
Oc90 T A 15: 65,889,614 D185V probably damaging Het
Olfr1025-ps1 A T 2: 85,918,038 T38S possibly damaging Het
Olfr1243 G A 2: 89,527,588 T274M probably damaging Het
Olfr150 A T 9: 39,737,618 K268* probably null Het
Olfr437 T C 6: 43,167,238 F60S probably damaging Het
Olfr470 T A 7: 107,845,590 T48S possibly damaging Het
Olfr56 G A 11: 49,134,978 R262K probably damaging Het
Pcdha8 A G 18: 36,994,348 T628A probably damaging Het
Pcsk5 A T 19: 17,572,622 probably null Het
Pdgfrb T C 18: 61,078,649 probably null Het
Pgm3 A T 9: 86,556,502 probably null Het
Pin1rt1 T A 2: 104,714,718 Y23F probably benign Het
Poli T A 18: 70,530,151 probably null Het
Pom121 C A 5: 135,381,124 probably benign Het
Ppp2r5c A G 12: 110,569,022 D407G possibly damaging Het
Rgs12 A G 5: 35,023,171 D116G probably null Het
Serpina3b A T 12: 104,132,992 E255D probably benign Het
Slc46a1 A G 11: 78,466,964 H281R probably damaging Het
Spata6 T C 4: 111,784,815 I294T probably benign Het
Srgap1 T A 10: 121,828,726 probably null Het
Stag1 C T 9: 100,944,850 R957C probably damaging Het
Stk35 G A 2: 129,801,653 E186K probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tenm4 G A 7: 96,895,271 V2165I probably damaging Het
Tmem53 T C 4: 117,268,331 S207P probably benign Het
Ugt2a3 A G 5: 87,336,758 F136L probably benign Het
Unc13d T C 11: 116,066,751 K795E probably damaging Het
Zbtb11 C A 16: 55,990,502 T341K probably benign Het
Other mutations in Esrra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01415:Esrra APN 19 6912732 missense probably damaging 1.00
IGL02153:Esrra APN 19 6913822 missense probably benign 0.38
IGL02396:Esrra APN 19 6912005 missense probably benign
IGL02642:Esrra APN 19 6912850 missense possibly damaging 0.85
R1463:Esrra UTSW 19 6912455 missense probably benign
R1484:Esrra UTSW 19 6912829 missense probably damaging 1.00
R1546:Esrra UTSW 19 6920297 missense probably benign 0.07
R1848:Esrra UTSW 19 6912010 missense probably benign 0.05
R2397:Esrra UTSW 19 6920176 missense probably damaging 1.00
R4853:Esrra UTSW 19 6920072 missense probably damaging 1.00
R5580:Esrra UTSW 19 6920387 start codon destroyed probably null 0.01
R5587:Esrra UTSW 19 6920207 missense probably benign
R6270:Esrra UTSW 19 6914120 unclassified probably null
R6612:Esrra UTSW 19 6911852 missense probably benign 0.01
R7288:Esrra UTSW 19 6912771 nonsense probably null
R7599:Esrra UTSW 19 6913846 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGGGCATTCACTTTCCTGG -3'
(R):5'- TGCTGGAGTATGAAGCTGGC -3'

Sequencing Primer
(F):5'- GGCTTCTGACAATCCCCCAC -3'
(R):5'- TATGAAGCTGGCCGGGCTG -3'
Posted On2018-09-12