Mutagenetix > Incidental Mutation

Incidental Mutation 'R6808:Erbb4'

533641

Institutional Source

Beutler Lab

Gene Symbol

Erbb4

Ensembl Gene

ENSMUSG00000062209

Gene Name

erb-b2 receptor tyrosine kinase 4

Synonyms

Her4, ErbB4

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6808 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

68032186-69108059 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 68040303 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1206 (M1206K)

Ref Sequence

ENSEMBL: ENSMUSP00000114123 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473]

AlphaFold

Q61527

Predicted Effect

probably benign
Transcript: ENSMUST00000119142
AA Change: M1222K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: M1222K

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Recep_L_domain	55	167	5e-34	PFAM
FU	183	223	2.07e1	SMART
FU	226	268	5.78e-10	SMART
Pfam:Recep_L_domain	358	478	1e-29	PFAM
FU	493	544	6.45e-8	SMART
FU	549	599	3.51e-9	SMART
FU	611	659	2.32e0	SMART
TyrKc	718	974	7.53e-133	SMART
low complexity region	1007	1023	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121473
AA Change: M1206K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: M1206K

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Recep_L_domain	55	167	1.6e-34	PFAM
FU	183	223	2.07e1	SMART
FU	226	268	5.78e-10	SMART
Pfam:Recep_L_domain	358	478	5.5e-29	PFAM
FU	493	544	6.45e-8	SMART
FU	549	599	3.51e-9	SMART
FU	611	659	2.32e0	SMART
TyrKc	718	974	7.53e-133	SMART
low complexity region	1007	1023	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.7%

Validation Efficiency

100% (40/40)

MGI Phenotype

Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl9	A	T	17: 33,433,124	I53F	probably damaging	Het
Apol7b	T	A	15: 77,424,673	D75V	probably damaging	Het
Brd8	C	T	18: 34,608,475	A387T	probably damaging	Het
C87499	T	C	4: 88,630,054	E38G	probably damaging	Het
Cacybp	T	C	1: 160,208,599		probably null	Het
Calcoco1	T	C	15: 102,710,440	K444E	probably damaging	Het
Cers2	G	A	3: 95,321,009	R120H	probably benign	Het
Chd4	T	A	6: 125,122,123	C1587S	possibly damaging	Het
Col11a1	A	T	3: 114,094,944	K286N	possibly damaging	Het
Creld2	A	G	15: 88,825,210	N308S	probably damaging	Het
Cyp2d12	T	C	15: 82,556,733	S151P	probably damaging	Het
Dlec1	A	G	9: 119,126,174	H642R	probably benign	Het
Eif6	T	C	2: 155,823,286	Y151C	probably damaging	Het
Fam178b	G	A	1: 36,600,135	T361M	probably damaging	Het
Fbxo10	A	G	4: 45,059,035	F234S	probably benign	Het
Gcc2	A	T	10: 58,258,242	E13D	probably damaging	Het
Gm19410	C	A	8: 35,772,579	A143E	probably damaging	Het
Gtf3c5	T	C	2: 28,570,487	K367E	probably damaging	Het
Ifi204	T	C	1: 173,761,703	E54G	probably benign	Het
Kalrn	A	T	16: 34,027,976	I492N	probably damaging	Het
Kif1bp	T	C	10: 62,575,144	N140S	possibly damaging	Het
Map2k5	A	G	9: 63,322,246	Y168H	probably benign	Het
Mbip	A	C	12: 56,337,598		probably null	Het
Mcmdc2	C	T	1: 9,934,017	T574I	probably damaging	Het
Olfr1412	A	T	1: 92,589,046	R239W	probably damaging	Het
Olfr153	A	T	2: 87,532,941	M303L	probably benign	Het
Olfr516	T	C	7: 108,845,540	T157A	probably benign	Het
Olfr592	T	G	7: 103,187,304	D234E	probably benign	Het
Olfr924	T	A	9: 38,848,789	I225N	probably damaging	Het
Olfr952	T	C	9: 39,426,540	Y177C	probably damaging	Het
Pdzd8	A	G	19: 59,299,525	*1148Q	probably null	Het
Phactr1	T	A	13: 43,132,969	I582N	probably damaging	Het
Phf20l1	T	G	15: 66,630,913	L714R	probably damaging	Het
Rcor3	T	C	1: 192,137,882	E6G	possibly damaging	Het
Sptlc2	G	A	12: 87,350,295	T239I	possibly damaging	Het
Tmc1	A	T	19: 20,795,516	V707D	probably damaging	Het
Tmem63b	T	A	17: 45,660,808	E827V	probably benign	Het
Triml1	A	G	8: 43,141,221	S58P	probably damaging	Het
Ttc37	T	C	13: 76,185,179	S1516P	probably damaging	Het
Zdbf2	A	G	1: 63,308,528	H2022R	possibly damaging	Het

Other mutations in Erbb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00965:Erbb4	APN	1	68071630	nonsense	probably null
IGL01020:Erbb4	APN	1	68298449	splice site	probably benign
IGL01349:Erbb4	APN	1	68346593	missense	probably benign	0.00
IGL01386:Erbb4	APN	1	68343931	missense	probably damaging	1.00
IGL01516:Erbb4	APN	1	68328245	nonsense	probably null
IGL01536:Erbb4	APN	1	68290282	missense	probably benign	0.00
IGL01721:Erbb4	APN	1	68254563	missense	possibly damaging	0.46
IGL01832:Erbb4	APN	1	68254566	missense	possibly damaging	0.84
IGL02002:Erbb4	APN	1	68080726	missense	probably damaging	1.00
IGL02040:Erbb4	APN	1	68042535	missense	probably damaging	1.00
IGL02371:Erbb4	APN	1	68290294	missense	probably benign	0.00
IGL02399:Erbb4	APN	1	68042437	splice site	probably benign
IGL02553:Erbb4	APN	1	68305864	missense	probably benign	0.17
IGL03118:Erbb4	APN	1	68042719	missense	probably benign	0.11
IGL03329:Erbb4	APN	1	68328122	missense	probably benign	0.30
IGL03405:Erbb4	APN	1	68330238	missense	probably benign	0.02
earthworm	UTSW	1	68250580	missense	possibly damaging	0.67
excrescence	UTSW	1	68330246	missense	probably damaging	1.00
Mole	UTSW	1	68560576	missense	probably damaging	1.00
P0018:Erbb4	UTSW	1	68071676	missense	probably benign	0.05
PIT4480001:Erbb4	UTSW	1	68075543	missense	probably damaging	1.00
R0193:Erbb4	UTSW	1	68043960	intron	probably benign
R0329:Erbb4	UTSW	1	68298280	splice site	probably benign
R0335:Erbb4	UTSW	1	68259259	missense	probably benign
R0362:Erbb4	UTSW	1	68330270	missense	probably damaging	0.99
R0579:Erbb4	UTSW	1	68042462	missense	probably benign	0.17
R0730:Erbb4	UTSW	1	68259290	missense	probably damaging	0.98
R1029:Erbb4	UTSW	1	68309614	missense	probably damaging	0.96
R1444:Erbb4	UTSW	1	68254600	missense	probably damaging	1.00
R1469:Erbb4	UTSW	1	68560682	missense	probably damaging	0.99
R1469:Erbb4	UTSW	1	68560682	missense	probably damaging	0.99
R1503:Erbb4	UTSW	1	68346546	missense	probably benign	0.00
R1523:Erbb4	UTSW	1	68396252	missense	possibly damaging	0.95
R1528:Erbb4	UTSW	1	68078582	nonsense	probably null
R1604:Erbb4	UTSW	1	68346569	missense	possibly damaging	0.88
R1611:Erbb4	UTSW	1	68040388	missense	probably damaging	1.00
R1642:Erbb4	UTSW	1	68331234	missense	probably damaging	1.00
R1905:Erbb4	UTSW	1	68075410	splice site	probably benign
R1929:Erbb4	UTSW	1	68198888	missense	probably damaging	0.98
R2046:Erbb4	UTSW	1	68298323	missense	probably benign	0.02
R2139:Erbb4	UTSW	1	68346629	missense	probably damaging	0.96
R2271:Erbb4	UTSW	1	68198888	missense	probably damaging	0.98
R2298:Erbb4	UTSW	1	68042531	missense	probably damaging	1.00
R2356:Erbb4	UTSW	1	68078596	missense	probably benign	0.00
R3821:Erbb4	UTSW	1	68305913	missense	probably damaging	0.97
R4007:Erbb4	UTSW	1	68740401	missense	probably damaging	1.00
R4012:Erbb4	UTSW	1	68560576	missense	probably damaging	1.00
R4077:Erbb4	UTSW	1	68040337	missense	probably benign	0.07
R4196:Erbb4	UTSW	1	68343855	missense	possibly damaging	0.90
R4536:Erbb4	UTSW	1	68346622	missense	probably damaging	1.00
R4561:Erbb4	UTSW	1	68343921	nonsense	probably null
R4642:Erbb4	UTSW	1	68250632	missense	probably damaging	1.00
R4737:Erbb4	UTSW	1	68343900	missense	probably damaging	0.98
R4739:Erbb4	UTSW	1	68343900	missense	probably damaging	0.98
R4780:Erbb4	UTSW	1	68298314	missense	probably damaging	1.00
R4801:Erbb4	UTSW	1	68330246	missense	probably damaging	1.00
R4802:Erbb4	UTSW	1	68330246	missense	probably damaging	1.00
R4811:Erbb4	UTSW	1	68254544	missense	probably damaging	1.00
R4832:Erbb4	UTSW	1	68330238	missense	probably benign	0.02
R5068:Erbb4	UTSW	1	68043902	splice site	probably null
R5546:Erbb4	UTSW	1	68298293	missense	probably damaging	0.99
R5755:Erbb4	UTSW	1	68560519	missense	possibly damaging	0.96
R6189:Erbb4	UTSW	1	68043916	missense	probably benign
R6257:Erbb4	UTSW	1	68396273	missense	probably damaging	1.00
R6276:Erbb4	UTSW	1	68560576	missense	probably damaging	1.00
R6521:Erbb4	UTSW	1	68042530	missense	probably damaging	1.00
R6602:Erbb4	UTSW	1	68370503	missense	probably damaging	0.99
R7087:Erbb4	UTSW	1	68740491	missense	probably null	1.00
R7215:Erbb4	UTSW	1	68339460	missense	probably benign
R7356:Erbb4	UTSW	1	68339355	critical splice donor site	probably null
R7509:Erbb4	UTSW	1	68250580	missense	possibly damaging	0.67
R7593:Erbb4	UTSW	1	68254599	missense	probably damaging	0.99
R7743:Erbb4	UTSW	1	68328119	missense	probably benign	0.00
R7784:Erbb4	UTSW	1	68075499	missense	probably damaging	1.00
R7815:Erbb4	UTSW	1	68042726	missense	probably damaging	1.00
R7923:Erbb4	UTSW	1	68259209	missense	probably damaging	1.00
R8071:Erbb4	UTSW	1	68396311	missense	probably damaging	1.00
R8288:Erbb4	UTSW	1	68298350	missense	probably damaging	1.00
R8356:Erbb4	UTSW	1	68071630	missense	probably damaging	1.00
R8456:Erbb4	UTSW	1	68071630	missense	probably damaging	1.00
R8464:Erbb4	UTSW	1	68309626	missense	probably benign
R8783:Erbb4	UTSW	1	68040172	missense	possibly damaging	0.95
R8830:Erbb4	UTSW	1	68075468	missense	probably damaging	1.00
R8881:Erbb4	UTSW	1	68343838	critical splice donor site	probably null
R9053:Erbb4	UTSW	1	68250620	missense	possibly damaging	0.63
R9142:Erbb4	UTSW	1	68349393	missense	probably damaging	1.00
R9237:Erbb4	UTSW	1	68042442	missense	possibly damaging	0.72
R9350:Erbb4	UTSW	1	68290479	missense	probably benign	0.00
R9374:Erbb4	UTSW	1	68740483	nonsense	probably null
R9434:Erbb4	UTSW	1	68042614	missense	possibly damaging	0.84
R9499:Erbb4	UTSW	1	68740483	nonsense	probably null
R9551:Erbb4	UTSW	1	68740483	nonsense	probably null
R9753:Erbb4	UTSW	1	68198903	missense	probably benign	0.00
X0019:Erbb4	UTSW	1	68073145	missense	probably benign	0.00
Z1176:Erbb4	UTSW	1	68298402	frame shift	probably null
Z1176:Erbb4	UTSW	1	68328259	nonsense	probably null
Z1177:Erbb4	UTSW	1	68259183	frame shift	probably null
Z1177:Erbb4	UTSW	1	68290476	missense	probably damaging	1.00
Z1177:Erbb4	UTSW	1	68309643	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- AGCATAGTGCCAGGCTTCAG -3'
(R):5'- TATCTGAATCCTGTGGAAGAGAAC -3'

Sequencing Primer
(F):5'- AGGATTCTCTGCCACAATGG -3'
(R):5'- AGAGAACCCTTTTGTGTCCCGAAG -3'

Posted On

2018-09-12