Incidental Mutation 'R6808:Olfr153'
ID533646
Institutional Source Beutler Lab
Gene Symbol Olfr153
Ensembl Gene ENSMUSG00000061520
Gene Nameolfactory receptor 153
SynonymsGA_x6K02T2Q125-49033418-49034341, MOR177-5, Olfr4-2, V5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R6808 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87531796-87533053 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87532941 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 303 (M303L)
Ref Sequence ENSEMBL: ENSMUSP00000149859 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000217113
AA Change: M303L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl9 A T 17: 33,433,124 I53F probably damaging Het
Apol7b T A 15: 77,424,673 D75V probably damaging Het
Brd8 C T 18: 34,608,475 A387T probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Cacybp T C 1: 160,208,599 probably null Het
Calcoco1 T C 15: 102,710,440 K444E probably damaging Het
Cers2 G A 3: 95,321,009 R120H probably benign Het
Chd4 T A 6: 125,122,123 C1587S possibly damaging Het
Col11a1 A T 3: 114,094,944 K286N possibly damaging Het
Creld2 A G 15: 88,825,210 N308S probably damaging Het
Cyp2d12 T C 15: 82,556,733 S151P probably damaging Het
Dlec1 A G 9: 119,126,174 H642R probably benign Het
Eif6 T C 2: 155,823,286 Y151C probably damaging Het
Erbb4 A T 1: 68,040,303 M1206K probably benign Het
Fam178b G A 1: 36,600,135 T361M probably damaging Het
Fbxo10 A G 4: 45,059,035 F234S probably benign Het
Gcc2 A T 10: 58,258,242 E13D probably damaging Het
Gm19410 C A 8: 35,772,579 A143E probably damaging Het
Gtf3c5 T C 2: 28,570,487 K367E probably damaging Het
Ifi204 T C 1: 173,761,703 E54G probably benign Het
Kalrn A T 16: 34,027,976 I492N probably damaging Het
Kif1bp T C 10: 62,575,144 N140S possibly damaging Het
Map2k5 A G 9: 63,322,246 Y168H probably benign Het
Mbip A C 12: 56,337,598 probably null Het
Mcmdc2 C T 1: 9,934,017 T574I probably damaging Het
Olfr1412 A T 1: 92,589,046 R239W probably damaging Het
Olfr516 T C 7: 108,845,540 T157A probably benign Het
Olfr592 T G 7: 103,187,304 D234E probably benign Het
Olfr924 T A 9: 38,848,789 I225N probably damaging Het
Olfr952 T C 9: 39,426,540 Y177C probably damaging Het
Pdzd8 A G 19: 59,299,525 *1148Q probably null Het
Phactr1 T A 13: 43,132,969 I582N probably damaging Het
Phf20l1 T G 15: 66,630,913 L714R probably damaging Het
Rcor3 T C 1: 192,137,882 E6G possibly damaging Het
Sptlc2 G A 12: 87,350,295 T239I possibly damaging Het
Tmc1 A T 19: 20,795,516 V707D probably damaging Het
Tmem63b T A 17: 45,660,808 E827V probably benign Het
Triml1 A G 8: 43,141,221 S58P probably damaging Het
Ttc37 T C 13: 76,185,179 S1516P probably damaging Het
Zdbf2 A G 1: 63,308,528 H2022R possibly damaging Het
Other mutations in Olfr153
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Olfr153 APN 2 87532285 missense probably benign 0.01
IGL02102:Olfr153 APN 2 87532461 missense probably benign
IGL02604:Olfr153 APN 2 87532605 missense probably damaging 0.98
IGL02695:Olfr153 APN 2 87532117 missense probably benign 0.00
IGL02961:Olfr153 APN 2 87532684 missense probably damaging 0.98
PIT4696001:Olfr153 UTSW 2 87532780 missense probably damaging 1.00
R0727:Olfr153 UTSW 2 87532901 nonsense probably null
R1534:Olfr153 UTSW 2 87532672 missense probably damaging 0.99
R1699:Olfr153 UTSW 2 87532083 missense probably benign 0.07
R1885:Olfr153 UTSW 2 87532824 missense probably damaging 0.99
R3705:Olfr153 UTSW 2 87532068 missense probably benign 0.01
R5664:Olfr153 UTSW 2 87532834 missense probably benign 0.35
R6492:Olfr153 UTSW 2 87532741 missense possibly damaging 0.66
R7432:Olfr153 UTSW 2 87532440 missense probably damaging 1.00
R7477:Olfr153 UTSW 2 87532087 missense probably benign 0.00
R8014:Olfr153 UTSW 2 87532164 missense probably benign 0.13
X0028:Olfr153 UTSW 2 87532039 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTCACTTGACTGCAGTTGC -3'
(R):5'- GCCTTGCTCTGTTATGCAATG -3'

Sequencing Primer
(F):5'- CTGCAGTTGCTATTTTTCAAGGAAC -3'
(R):5'- TGAGACACTTGAAAAAGCTGTCC -3'
Posted On2018-09-12