Incidental Mutation 'R6808:Olfr516'
ID533654
Institutional Source Beutler Lab
Gene Symbol Olfr516
Ensembl Gene ENSMUSG00000062434
Gene Nameolfactory receptor 516
SynonymsGA_x6K02T2PBJ9-11176324-11175380, MOR268-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6808 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location108844788-108850529 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108845540 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 157 (T157A)
Ref Sequence ENSEMBL: ENSMUSP00000150359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071410] [ENSMUST00000216092] [ENSMUST00000217279]
Predicted Effect probably benign
Transcript: ENSMUST00000071410
AA Change: T157A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000071358
Gene: ENSMUSG00000062434
AA Change: T157A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.2e-60 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.9e-5 PFAM
Pfam:7tm_1 41 290 9.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216092
AA Change: T157A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000217279
AA Change: T157A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.1138 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl9 A T 17: 33,433,124 I53F probably damaging Het
Apol7b T A 15: 77,424,673 D75V probably damaging Het
Brd8 C T 18: 34,608,475 A387T probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Cacybp T C 1: 160,208,599 probably null Het
Calcoco1 T C 15: 102,710,440 K444E probably damaging Het
Cers2 G A 3: 95,321,009 R120H probably benign Het
Chd4 T A 6: 125,122,123 C1587S possibly damaging Het
Col11a1 A T 3: 114,094,944 K286N possibly damaging Het
Creld2 A G 15: 88,825,210 N308S probably damaging Het
Cyp2d12 T C 15: 82,556,733 S151P probably damaging Het
Dlec1 A G 9: 119,126,174 H642R probably benign Het
Eif6 T C 2: 155,823,286 Y151C probably damaging Het
Erbb4 A T 1: 68,040,303 M1206K probably benign Het
Fam178b G A 1: 36,600,135 T361M probably damaging Het
Fbxo10 A G 4: 45,059,035 F234S probably benign Het
Gcc2 A T 10: 58,258,242 E13D probably damaging Het
Gm19410 C A 8: 35,772,579 A143E probably damaging Het
Gtf3c5 T C 2: 28,570,487 K367E probably damaging Het
Ifi204 T C 1: 173,761,703 E54G probably benign Het
Kalrn A T 16: 34,027,976 I492N probably damaging Het
Kif1bp T C 10: 62,575,144 N140S possibly damaging Het
Map2k5 A G 9: 63,322,246 Y168H probably benign Het
Mbip A C 12: 56,337,598 probably null Het
Mcmdc2 C T 1: 9,934,017 T574I probably damaging Het
Olfr1412 A T 1: 92,589,046 R239W probably damaging Het
Olfr153 A T 2: 87,532,941 M303L probably benign Het
Olfr592 T G 7: 103,187,304 D234E probably benign Het
Olfr924 T A 9: 38,848,789 I225N probably damaging Het
Olfr952 T C 9: 39,426,540 Y177C probably damaging Het
Pdzd8 A G 19: 59,299,525 *1148Q probably null Het
Phactr1 T A 13: 43,132,969 I582N probably damaging Het
Phf20l1 T G 15: 66,630,913 L714R probably damaging Het
Rcor3 T C 1: 192,137,882 E6G possibly damaging Het
Sptlc2 G A 12: 87,350,295 T239I possibly damaging Het
Tmc1 A T 19: 20,795,516 V707D probably damaging Het
Tmem63b T A 17: 45,660,808 E827V probably benign Het
Triml1 A G 8: 43,141,221 S58P probably damaging Het
Ttc37 T C 13: 76,185,179 S1516P probably damaging Het
Zdbf2 A G 1: 63,308,528 H2022R possibly damaging Het
Other mutations in Olfr516
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Olfr516 APN 7 108845680 missense probably damaging 0.99
R0583:Olfr516 UTSW 7 108845414 missense possibly damaging 0.87
R0939:Olfr516 UTSW 7 108845233 missense probably damaging 1.00
R1037:Olfr516 UTSW 7 108845984 missense probably benign 0.04
R1631:Olfr516 UTSW 7 108845857 missense probably damaging 1.00
R1691:Olfr516 UTSW 7 108845141 missense possibly damaging 0.60
R5153:Olfr516 UTSW 7 108845699 missense probably benign 0.03
R6114:Olfr516 UTSW 7 108845386 missense possibly damaging 0.53
R6305:Olfr516 UTSW 7 108845554 missense possibly damaging 0.87
R6896:Olfr516 UTSW 7 108845543 missense probably benign
R7544:Olfr516 UTSW 7 108845321 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TTCTGCCTCCCTGTAGTGGATG -3'
(R):5'- ACCATTTCCTTTGGTGGCTG -3'

Sequencing Primer
(F):5'- CTCCCTGTAGTGGATGGCATC -3'
(R):5'- CTGTTTTGTGCAGATGTACTTCATTC -3'
Posted On2018-09-12