Mutagenetix > Incidental Mutations

Incidental Mutation 'R6808:Kif1bp'

533662

Institutional Source

Beutler Lab

Gene Symbol

Kif1bp

Ensembl Gene

ENSMUSG00000036955

Gene Name

KIF1 binding protein

Synonyms

2510003E04Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6808 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62538626-62578457 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 62575144 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 140 (N140S)

Ref Sequence

ENSEMBL: ENSMUSP00000125162 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065887] [ENSMUST00000159704] [ENSMUST00000162525] [ENSMUST00000162759]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065887
AA Change: N140S

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000065160
Gene: ENSMUSG00000036955
AA Change: N140S

Domain	Start	End	E-Value	Type
low complexity region	39	84	N/A	INTRINSIC
Blast:TPR	204	235	1e-5	BLAST
Pfam:KBP_C	243	610	6.6e-124	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159704
AA Change: N140S

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000134770
Gene: ENSMUSG00000036955
AA Change: N140S

Domain	Start	End	E-Value	Type
low complexity region	39	84	N/A	INTRINSIC
Blast:TPR	204	235	1e-5	BLAST
Pfam:KBP_C	242	383	2.7e-36	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162525
AA Change: N140S

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000125162
Gene: ENSMUSG00000036955
AA Change: N140S

Domain	Start	End	E-Value	Type
low complexity region	39	84	N/A	INTRINSIC
Blast:TPR	204	235	6e-6	BLAST
Pfam:KBP_C	242	293	5.7e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000162759

SMART Domains

Protein: ENSMUSP00000125236
Gene: ENSMUSG00000036955

Domain	Start	End	E-Value	Type
low complexity region	39	84	N/A	INTRINSIC
Blast:TPR	204	235	1e-5	BLAST
Pfam:KBP_C	242	329	4.8e-28	PFAM
transmembrane domain	340	362	N/A	INTRINSIC
transmembrane domain	375	397	N/A	INTRINSIC

Meta Mutation Damage Score

0.0755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.7%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinesin family member 1 binding protein that is characterized by two tetratrico peptide repeats. The encoded protein localizes to the mitochondria and may be involved in regulating transport of the mitochondria. Mutations in this gene are associated with Goldberg-Shprintzen megacolon syndrome. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous KO mice die shortly after birth from respiratory failure. Knockout affects innervation of the digestive tract, and the development of the olfactory bulb and the anterior commissure in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl9	A	T	17: 33,433,124	I53F	probably damaging	Het
Apol7b	T	A	15: 77,424,673	D75V	probably damaging	Het
Brd8	C	T	18: 34,608,475	A387T	probably damaging	Het
C87499	T	C	4: 88,630,054	E38G	probably damaging	Het
Cacybp	T	C	1: 160,208,599		probably null	Het
Calcoco1	T	C	15: 102,710,440	K444E	probably damaging	Het
Cers2	G	A	3: 95,321,009	R120H	probably benign	Het
Chd4	T	A	6: 125,122,123	C1587S	possibly damaging	Het
Col11a1	A	T	3: 114,094,944	K286N	possibly damaging	Het
Creld2	A	G	15: 88,825,210	N308S	probably damaging	Het
Cyp2d12	T	C	15: 82,556,733	S151P	probably damaging	Het
Dlec1	A	G	9: 119,126,174	H642R	probably benign	Het
Eif6	T	C	2: 155,823,286	Y151C	probably damaging	Het
Erbb4	A	T	1: 68,040,303	M1206K	probably benign	Het
Fam178b	G	A	1: 36,600,135	T361M	probably damaging	Het
Fbxo10	A	G	4: 45,059,035	F234S	probably benign	Het
Gcc2	A	T	10: 58,258,242	E13D	probably damaging	Het
Gm19410	C	A	8: 35,772,579	A143E	probably damaging	Het
Gtf3c5	T	C	2: 28,570,487	K367E	probably damaging	Het
Ifi204	T	C	1: 173,761,703	E54G	probably benign	Het
Kalrn	A	T	16: 34,027,976	I492N	probably damaging	Het
Map2k5	A	G	9: 63,322,246	Y168H	probably benign	Het
Mbip	A	C	12: 56,337,598		probably null	Het
Mcmdc2	C	T	1: 9,934,017	T574I	probably damaging	Het
Olfr1412	A	T	1: 92,589,046	R239W	probably damaging	Het
Olfr153	A	T	2: 87,532,941	M303L	probably benign	Het
Olfr516	T	C	7: 108,845,540	T157A	probably benign	Het
Olfr592	T	G	7: 103,187,304	D234E	probably benign	Het
Olfr924	T	A	9: 38,848,789	I225N	probably damaging	Het
Olfr952	T	C	9: 39,426,540	Y177C	probably damaging	Het
Pdzd8	A	G	19: 59,299,525	*1148Q	probably null	Het
Phactr1	T	A	13: 43,132,969	I582N	probably damaging	Het
Phf20l1	T	G	15: 66,630,913	L714R	probably damaging	Het
Rcor3	T	C	1: 192,137,882	E6G	possibly damaging	Het
Sptlc2	G	A	12: 87,350,295	T239I	possibly damaging	Het
Tmc1	A	T	19: 20,795,516	V707D	probably damaging	Het
Tmem63b	T	A	17: 45,660,808	E827V	probably benign	Het
Triml1	A	G	8: 43,141,221	S58P	probably damaging	Het
Ttc37	T	C	13: 76,185,179	S1516P	probably damaging	Het
Zdbf2	A	G	1: 63,308,528	H2022R	possibly damaging	Het

Other mutations in Kif1bp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00566:Kif1bp	APN	10	62559339	nonsense	probably null
IGL02127:Kif1bp	APN	10	62578349	missense	probably benign	0.00
IGL03304:Kif1bp	APN	10	62559303	missense	probably damaging	1.00
IGL02980:Kif1bp	UTSW	10	62559168	missense	probably damaging	1.00
R0317:Kif1bp	UTSW	10	62578082	unclassified	probably null
R0408:Kif1bp	UTSW	10	62566053	missense	probably benign	0.37
R0462:Kif1bp	UTSW	10	62559456	missense	probably damaging	1.00
R1469:Kif1bp	UTSW	10	62559450	missense	probably damaging	0.96
R1469:Kif1bp	UTSW	10	62559450	missense	probably damaging	0.96
R1503:Kif1bp	UTSW	10	62559408	missense	probably damaging	0.98
R1830:Kif1bp	UTSW	10	62559327	missense	probably damaging	1.00
R3848:Kif1bp	UTSW	10	62569470	missense	probably damaging	1.00
R4486:Kif1bp	UTSW	10	62563027	intron	probably benign
R4488:Kif1bp	UTSW	10	62563027	intron	probably benign
R4489:Kif1bp	UTSW	10	62563027	intron	probably benign
R5137:Kif1bp	UTSW	10	62578241	missense	probably damaging	1.00
R5193:Kif1bp	UTSW	10	62559396	missense	possibly damaging	0.81
R5212:Kif1bp	UTSW	10	62563129	intron	probably benign
R5929:Kif1bp	UTSW	10	62559402	missense	probably damaging	1.00
R6179:Kif1bp	UTSW	10	62563250	nonsense	probably null
R6488:Kif1bp	UTSW	10	62559658	intron	probably null
R6513:Kif1bp	UTSW	10	62575034	intron	probably null
R6900:Kif1bp	UTSW	10	62559129	missense	probably damaging	1.00
R6916:Kif1bp	UTSW	10	62566064	missense	probably benign	0.05
R7092:Kif1bp	UTSW	10	62578300	missense	probably damaging	1.00
R7289:Kif1bp	UTSW	10	62566116	missense	probably damaging	1.00
R7376:Kif1bp	UTSW	10	62559064	missense	possibly damaging	0.89
R7672:Kif1bp	UTSW	10	62578073	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACCTCTAAAGAGAAGTTTCTGGG -3'
(R):5'- CATGGACTGTGGCTGTAGTAAC -3'

Sequencing Primer
(F):5'- AGATCTTCATGCTCGCAAGG -3'
(R):5'- TAACAGACAGCGGGACAGCTC -3'

Posted On

2018-09-12