Incidental Mutation 'R6808:Sptlc2'
ID533664
Institutional Source Beutler Lab
Gene Symbol Sptlc2
Ensembl Gene ENSMUSG00000021036
Gene Nameserine palmitoyltransferase, long chain base subunit 2
SynonymsLCB2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6808 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location87305058-87388355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87350295 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 239 (T239I)
Ref Sequence ENSEMBL: ENSMUSP00000021424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021424]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021424
AA Change: T239I

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021424
Gene: ENSMUSG00000021036
AA Change: T239I

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 166 526 7.2e-60 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a long chain base subunit of serine palmitoyltransferase. The enzyme, serine palmitoyltransferase, consists of two different subunits, and is the key enzyme in sphingolipid biosynthesis. It catalyzes the pyridoxal-5-prime-phosphate-dependent condensation of L-serine and palmitoyl-CoA to 3-oxosphinganine. A mutant allele of this gene in mice is used as a model for the human disease 'Susceptibilty to Psoriasis 1'. Mutations in the human gene are associated with hereditary sensory neuropathy type I. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for this allele exhibit abnormal liver and circulating shingolipid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl9 A T 17: 33,433,124 I53F probably damaging Het
Apol7b T A 15: 77,424,673 D75V probably damaging Het
Brd8 C T 18: 34,608,475 A387T probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Cacybp T C 1: 160,208,599 probably null Het
Calcoco1 T C 15: 102,710,440 K444E probably damaging Het
Cers2 G A 3: 95,321,009 R120H probably benign Het
Chd4 T A 6: 125,122,123 C1587S possibly damaging Het
Col11a1 A T 3: 114,094,944 K286N possibly damaging Het
Creld2 A G 15: 88,825,210 N308S probably damaging Het
Cyp2d12 T C 15: 82,556,733 S151P probably damaging Het
Dlec1 A G 9: 119,126,174 H642R probably benign Het
Eif6 T C 2: 155,823,286 Y151C probably damaging Het
Erbb4 A T 1: 68,040,303 M1206K probably benign Het
Fam178b G A 1: 36,600,135 T361M probably damaging Het
Fbxo10 A G 4: 45,059,035 F234S probably benign Het
Gcc2 A T 10: 58,258,242 E13D probably damaging Het
Gm19410 C A 8: 35,772,579 A143E probably damaging Het
Gtf3c5 T C 2: 28,570,487 K367E probably damaging Het
Ifi204 T C 1: 173,761,703 E54G probably benign Het
Kalrn A T 16: 34,027,976 I492N probably damaging Het
Kif1bp T C 10: 62,575,144 N140S possibly damaging Het
Map2k5 A G 9: 63,322,246 Y168H probably benign Het
Mbip A C 12: 56,337,598 probably null Het
Mcmdc2 C T 1: 9,934,017 T574I probably damaging Het
Olfr1412 A T 1: 92,589,046 R239W probably damaging Het
Olfr153 A T 2: 87,532,941 M303L probably benign Het
Olfr516 T C 7: 108,845,540 T157A probably benign Het
Olfr592 T G 7: 103,187,304 D234E probably benign Het
Olfr924 T A 9: 38,848,789 I225N probably damaging Het
Olfr952 T C 9: 39,426,540 Y177C probably damaging Het
Pdzd8 A G 19: 59,299,525 *1148Q probably null Het
Phactr1 T A 13: 43,132,969 I582N probably damaging Het
Phf20l1 T G 15: 66,630,913 L714R probably damaging Het
Rcor3 T C 1: 192,137,882 E6G possibly damaging Het
Tmc1 A T 19: 20,795,516 V707D probably damaging Het
Tmem63b T A 17: 45,660,808 E827V probably benign Het
Triml1 A G 8: 43,141,221 S58P probably damaging Het
Ttc37 T C 13: 76,185,179 S1516P probably damaging Het
Zdbf2 A G 1: 63,308,528 H2022R possibly damaging Het
Other mutations in Sptlc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Sptlc2 APN 12 87369068 missense probably damaging 0.99
IGL02458:Sptlc2 APN 12 87309893 utr 3 prime probably benign
IGL02734:Sptlc2 APN 12 87355670 missense probably damaging 0.97
IGL03252:Sptlc2 APN 12 87355657 missense probably benign 0.00
lopsided UTSW 12 87341565 missense probably benign 0.27
shinola UTSW 12 87350295 missense possibly damaging 0.64
R0087:Sptlc2 UTSW 12 87369118 missense probably benign
R0116:Sptlc2 UTSW 12 87356680 missense probably benign 0.00
R0492:Sptlc2 UTSW 12 87346806 splice site probably null
R1353:Sptlc2 UTSW 12 87341746 missense probably damaging 1.00
R1470:Sptlc2 UTSW 12 87355640 missense probably benign 0.00
R1470:Sptlc2 UTSW 12 87355640 missense probably benign 0.00
R3417:Sptlc2 UTSW 12 87346808 splice site probably benign
R3735:Sptlc2 UTSW 12 87341565 missense probably benign 0.27
R3736:Sptlc2 UTSW 12 87341565 missense probably benign 0.27
R4278:Sptlc2 UTSW 12 87336151 missense probably benign 0.04
R5252:Sptlc2 UTSW 12 87336055 missense possibly damaging 0.49
R5593:Sptlc2 UTSW 12 87369083 missense probably benign 0.11
R5656:Sptlc2 UTSW 12 87346761 missense probably damaging 1.00
R5801:Sptlc2 UTSW 12 87341771 splice site probably null
R6256:Sptlc2 UTSW 12 87355531 missense probably damaging 1.00
R6280:Sptlc2 UTSW 12 87388131 missense probably benign
R6520:Sptlc2 UTSW 12 87355662 missense probably benign
R7133:Sptlc2 UTSW 12 87350377 missense probably benign 0.00
R7274:Sptlc2 UTSW 12 87341606 missense probably benign 0.24
R7366:Sptlc2 UTSW 12 87314049 critical splice donor site probably null
R7602:Sptlc2 UTSW 12 87341689 missense probably damaging 0.99
Z1177:Sptlc2 UTSW 12 87369044 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTAGGAGGAAAGCTCCAACTG -3'
(R):5'- ACCATGCCTGGACTGAAAATG -3'

Sequencing Primer
(F):5'- CTAGGAGGAAAGCTCCAACTGATATC -3'
(R):5'- TGTAGGTCAAAGGACAACTCTTAG -3'
Posted On2018-09-12