Incidental Mutation 'R6808:Creld2'
ID533670
Institutional Source Beutler Lab
Gene Symbol Creld2
Ensembl Gene ENSMUSG00000023272
Gene Namecysteine-rich with EGF-like domains 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6808 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location88819646-88826683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88825210 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 308 (N308S)
Ref Sequence ENSEMBL: ENSMUSP00000024042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024042]
Predicted Effect probably damaging
Transcript: ENSMUST00000024042
AA Change: N308S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024042
Gene: ENSMUSG00000023272
AA Change: N308S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF3456 28 86 1.3e-7 PFAM
low complexity region 90 100 N/A INTRINSIC
EGF 137 176 3.76e-1 SMART
FU 191 238 1.2e-7 SMART
EGF_like 228 273 1.76e-3 SMART
FU 251 298 5.08e-6 SMART
EGF_CA 288 329 3.17e-8 SMART
Meta Mutation Damage Score 0.7468 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl9 A T 17: 33,433,124 I53F probably damaging Het
Apol7b T A 15: 77,424,673 D75V probably damaging Het
Brd8 C T 18: 34,608,475 A387T probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Cacybp T C 1: 160,208,599 probably null Het
Calcoco1 T C 15: 102,710,440 K444E probably damaging Het
Cers2 G A 3: 95,321,009 R120H probably benign Het
Chd4 T A 6: 125,122,123 C1587S possibly damaging Het
Col11a1 A T 3: 114,094,944 K286N possibly damaging Het
Cyp2d12 T C 15: 82,556,733 S151P probably damaging Het
Dlec1 A G 9: 119,126,174 H642R probably benign Het
Eif6 T C 2: 155,823,286 Y151C probably damaging Het
Erbb4 A T 1: 68,040,303 M1206K probably benign Het
Fam178b G A 1: 36,600,135 T361M probably damaging Het
Fbxo10 A G 4: 45,059,035 F234S probably benign Het
Gcc2 A T 10: 58,258,242 E13D probably damaging Het
Gm19410 C A 8: 35,772,579 A143E probably damaging Het
Gtf3c5 T C 2: 28,570,487 K367E probably damaging Het
Ifi204 T C 1: 173,761,703 E54G probably benign Het
Kalrn A T 16: 34,027,976 I492N probably damaging Het
Kif1bp T C 10: 62,575,144 N140S possibly damaging Het
Map2k5 A G 9: 63,322,246 Y168H probably benign Het
Mbip A C 12: 56,337,598 probably null Het
Mcmdc2 C T 1: 9,934,017 T574I probably damaging Het
Olfr1412 A T 1: 92,589,046 R239W probably damaging Het
Olfr153 A T 2: 87,532,941 M303L probably benign Het
Olfr516 T C 7: 108,845,540 T157A probably benign Het
Olfr592 T G 7: 103,187,304 D234E probably benign Het
Olfr924 T A 9: 38,848,789 I225N probably damaging Het
Olfr952 T C 9: 39,426,540 Y177C probably damaging Het
Pdzd8 A G 19: 59,299,525 *1148Q probably null Het
Phactr1 T A 13: 43,132,969 I582N probably damaging Het
Phf20l1 T G 15: 66,630,913 L714R probably damaging Het
Rcor3 T C 1: 192,137,882 E6G possibly damaging Het
Sptlc2 G A 12: 87,350,295 T239I possibly damaging Het
Tmc1 A T 19: 20,795,516 V707D probably damaging Het
Tmem63b T A 17: 45,660,808 E827V probably benign Het
Triml1 A G 8: 43,141,221 S58P probably damaging Het
Ttc37 T C 13: 76,185,179 S1516P probably damaging Het
Zdbf2 A G 1: 63,308,528 H2022R possibly damaging Het
Other mutations in Creld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0510:Creld2 UTSW 15 88819956 missense probably damaging 1.00
R1137:Creld2 UTSW 15 88820631 nonsense probably null
R1163:Creld2 UTSW 15 88820631 nonsense probably null
R1164:Creld2 UTSW 15 88820631 nonsense probably null
R1206:Creld2 UTSW 15 88820631 nonsense probably null
R1207:Creld2 UTSW 15 88820631 nonsense probably null
R1207:Creld2 UTSW 15 88820631 nonsense probably null
R1457:Creld2 UTSW 15 88823753 missense probably damaging 1.00
R1475:Creld2 UTSW 15 88820631 nonsense probably null
R1915:Creld2 UTSW 15 88820631 nonsense probably null
R2105:Creld2 UTSW 15 88820631 nonsense probably null
R4297:Creld2 UTSW 15 88823753 missense probably damaging 1.00
R5843:Creld2 UTSW 15 88826429 missense probably damaging 1.00
R6066:Creld2 UTSW 15 88823766 missense possibly damaging 0.95
R6402:Creld2 UTSW 15 88823141 missense probably damaging 0.99
R6454:Creld2 UTSW 15 88823071 nonsense probably null
R6543:Creld2 UTSW 15 88825278 missense probably benign 0.00
R6912:Creld2 UTSW 15 88819997 missense probably damaging 1.00
R7342:Creld2 UTSW 15 88826407 missense probably benign 0.03
R8058:Creld2 UTSW 15 88826429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCATGATCCCATCCTGTTG -3'
(R):5'- TGCACTGCACAAACTTTTCACC -3'

Sequencing Primer
(F):5'- CCTGTTGCTCTCATTGATAAAGG -3'
(R):5'- ACCAGGGCAACTCTGTGTTAATTTC -3'
Posted On2018-09-12