Incidental Mutation 'R6809:Psip1'
ID533697
Institutional Source Beutler Lab
Gene Symbol Psip1
Ensembl Gene ENSMUSG00000028484
Gene NamePC4 and SFRS1 interacting protein 1
SynonymsPsip2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.551) question?
Stock #R6809 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location83455680-83486459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83468642 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 164 (M164T)
Ref Sequence ENSEMBL: ENSMUSP00000102833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030207] [ENSMUST00000107214] [ENSMUST00000107215] [ENSMUST00000124856] [ENSMUST00000143533]
Predicted Effect probably benign
Transcript: ENSMUST00000030207
AA Change: M164T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030207
Gene: ENSMUSG00000028484
AA Change: M164T

DomainStartEndE-ValueType
PWWP 5 62 1.98e-17 SMART
low complexity region 143 155 N/A INTRINSIC
low complexity region 212 255 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 327 343 N/A INTRINSIC
Pfam:LEDGF 347 448 4.4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107214
AA Change: M164T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102832
Gene: ENSMUSG00000028484
AA Change: M164T

DomainStartEndE-ValueType
PWWP 5 62 1.98e-17 SMART
low complexity region 143 155 N/A INTRINSIC
low complexity region 212 255 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107215
AA Change: M164T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102833
Gene: ENSMUSG00000028484
AA Change: M164T

DomainStartEndE-ValueType
PWWP 5 62 1.98e-17 SMART
low complexity region 143 155 N/A INTRINSIC
low complexity region 212 255 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 316 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124856
SMART Domains Protein: ENSMUSP00000124181
Gene: ENSMUSG00000028483

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 197 403 3.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126706
SMART Domains Protein: ENSMUSP00000120799
Gene: ENSMUSG00000028484

DomainStartEndE-ValueType
low complexity region 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143533
SMART Domains Protein: ENSMUSP00000123793
Gene: ENSMUSG00000028483

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 197 403 3.3e-76 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 96% (51/53)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene tend to die perinatally. Survivors show reduced fertility and a variety of skeletal and behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,874,282 N61S probably damaging Het
A130010J15Rik T A 1: 193,174,781 V147E possibly damaging Het
Adgrv1 A T 13: 81,472,953 M3893K probably benign Het
Aox3 T C 1: 58,118,681 S66P probably damaging Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Bloc1s5 A G 13: 38,603,985 V141A probably benign Het
Btbd11 A G 10: 85,631,376 T732A probably benign Het
Col28a1 T C 6: 7,999,468 Y1083C probably damaging Het
Crb1 A G 1: 139,243,126 V842A probably benign Het
Dapk1 A G 13: 60,751,289 S858G probably benign Het
Dlgap2 G T 8: 14,179,619 probably benign Het
Dpysl4 A G 7: 139,093,660 D199G probably benign Het
Eml6 C T 11: 29,803,161 V917I probably benign Het
Fut9 T A 4: 25,620,647 T56S probably benign Het
Gm6205 C A 5: 94,683,418 Q95K probably benign Het
Gtdc1 G C 2: 44,575,551 S214* probably null Het
Gtdc1 A G 2: 44,825,384 F49S probably damaging Het
Hoxd9 A G 2: 74,699,246 Y282C probably damaging Het
Hrc A G 7: 45,336,379 E318G probably benign Het
Ikzf2 T C 1: 69,570,502 T195A probably damaging Het
Krt36 A T 11: 100,105,509 S30T probably benign Het
Lrp1 A G 10: 127,555,056 F2991L probably benign Het
Lrrc34 T A 3: 30,634,600 Q184L possibly damaging Het
Mapk1 A T 16: 17,035,462 M49L probably benign Het
Mroh2a G T 1: 88,235,216 Q360H probably benign Het
Mrpl48 A G 7: 100,546,367 probably benign Het
Ncln A G 10: 81,487,678 probably null Het
Nol4 T A 18: 22,920,825 Q96L probably damaging Het
Olfr1002 G A 2: 85,647,973 A116V probably damaging Het
Olfr1391 G T 11: 49,327,860 V150L probably benign Het
Padi2 A G 4: 140,946,766 probably null Het
Pak7 T G 2: 136,097,581 I545L possibly damaging Het
Paqr5 T A 9: 61,968,782 R157W probably null Het
Pard3b G A 1: 62,161,181 R293H probably damaging Het
Phf11d C A 14: 59,356,395 C110F probably damaging Het
Pkn2 G A 3: 142,799,004 P804S probably damaging Het
Pnpla6 G A 8: 3,534,611 C743Y possibly damaging Het
Pramef17 A G 4: 143,993,081 V238A probably benign Het
Rgs22 C G 15: 36,048,764 S914T probably damaging Het
Rufy4 G A 1: 74,133,047 V310I probably benign Het
Ryr2 G A 13: 11,726,930 L2122F probably damaging Het
Sgcb T G 5: 73,640,693 N142T probably benign Het
Slc27a6 A G 18: 58,605,054 E394G probably benign Het
Slc29a2 T C 19: 5,029,243 V298A probably damaging Het
Slf2 C A 19: 44,943,468 T654N probably damaging Het
Spata4 A C 8: 54,602,333 K123Q possibly damaging Het
Taar7b T C 10: 24,000,858 V307A probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ttn T C 2: 76,863,639 E295G possibly damaging Het
Ubqln4 A T 3: 88,555,372 Q48L possibly damaging Het
Ugt1a10 T A 1: 88,055,925 D148E probably damaging Het
Vmn2r85 T A 10: 130,425,926 N181Y probably benign Het
Wdfy3 C T 5: 101,923,947 V1026I possibly damaging Het
Other mutations in Psip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02414:Psip1 APN 4 83468637 missense probably benign 0.00
IGL02801:Psip1 APN 4 83458120 missense probably benign 0.02
IGL02995:Psip1 APN 4 83463717 intron probably benign
IGL03070:Psip1 APN 4 83465081 missense probably damaging 0.99
IGL03381:Psip1 APN 4 83485785 missense probably benign 0.03
R0167:Psip1 UTSW 4 83466818 unclassified probably null
R0288:Psip1 UTSW 4 83464959 missense probably damaging 1.00
R0365:Psip1 UTSW 4 83485712 splice site probably null
R0514:Psip1 UTSW 4 83460037 missense probably damaging 1.00
R0590:Psip1 UTSW 4 83458144 missense probably benign 0.00
R0734:Psip1 UTSW 4 83463588 intron probably benign
R0774:Psip1 UTSW 4 83460452 frame shift probably null
R1016:Psip1 UTSW 4 83459898 missense possibly damaging 0.48
R1256:Psip1 UTSW 4 83474367 missense probably benign
R1819:Psip1 UTSW 4 83458163 missense probably benign 0.01
R1993:Psip1 UTSW 4 83482532 missense probably damaging 0.99
R5423:Psip1 UTSW 4 83460130 intron probably benign
R5940:Psip1 UTSW 4 83476322 missense probably damaging 1.00
R6173:Psip1 UTSW 4 83473049 unclassified probably null
R6200:Psip1 UTSW 4 83474373 missense probably benign 0.20
R7488:Psip1 UTSW 4 83473038 critical splice donor site probably null
RF005:Psip1 UTSW 4 83460498 missense probably damaging 1.00
RF024:Psip1 UTSW 4 83460498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCATTGGATTCTCCCAGTG -3'
(R):5'- TCAGATGTCAGTCTCGGTTGAG -3'

Sequencing Primer
(F):5'- CAGTGTTCAAGATCTAGCCTGGAC -3'
(R):5'- GAAATAGCAATGTGAATCGTTACG -3'
Posted On2018-09-12