Incidental Mutation 'R6809:Dlgap2'
ID533709
Institutional Source Beutler Lab
Gene Symbol Dlgap2
Ensembl Gene ENSMUSG00000047495
Gene NameDLG associated protein 2
SynonymsPSD-95/SAP90-binding protein 2, DAP2, Sapap2, 6430596N04Rik, SAP90/PSD-95-associated protein 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6809 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location14095865-14847680 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 14179619 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043279] [ENSMUST00000133298] [ENSMUST00000150247] [ENSMUST00000152652]
Predicted Effect probably benign
Transcript: ENSMUST00000043279
SMART Domains Protein: ENSMUSP00000039647
Gene: ENSMUSG00000047495

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133298
SMART Domains Protein: ENSMUSP00000119613
Gene: ENSMUSG00000047495

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150247
SMART Domains Protein: ENSMUSP00000123104
Gene: ENSMUSG00000047495

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1045 1e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152652
SMART Domains Protein: ENSMUSP00000123078
Gene: ENSMUSG00000047495

DomainStartEndE-ValueType
low complexity region 270 295 N/A INTRINSIC
low complexity region 298 311 N/A INTRINSIC
low complexity region 447 457 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Pfam:GKAP 715 1060 1.9e-160 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that may play a role in synapse organization and signalling in neuronal cells. This gene is biallelically expressed in the brain, however, only the paternal allele is expressed in the testis (PMID:18055845). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,874,282 N61S probably damaging Het
A130010J15Rik T A 1: 193,174,781 V147E possibly damaging Het
Adgrv1 A T 13: 81,472,953 M3893K probably benign Het
Aox3 T C 1: 58,118,681 S66P probably damaging Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Bloc1s5 A G 13: 38,603,985 V141A probably benign Het
Btbd11 A G 10: 85,631,376 T732A probably benign Het
Col28a1 T C 6: 7,999,468 Y1083C probably damaging Het
Crb1 A G 1: 139,243,126 V842A probably benign Het
Dapk1 A G 13: 60,751,289 S858G probably benign Het
Dpysl4 A G 7: 139,093,660 D199G probably benign Het
Eml6 C T 11: 29,803,161 V917I probably benign Het
Fut9 T A 4: 25,620,647 T56S probably benign Het
Gm6205 C A 5: 94,683,418 Q95K probably benign Het
Gtdc1 G C 2: 44,575,551 S214* probably null Het
Gtdc1 A G 2: 44,825,384 F49S probably damaging Het
Hoxd9 A G 2: 74,699,246 Y282C probably damaging Het
Hrc A G 7: 45,336,379 E318G probably benign Het
Ikzf2 T C 1: 69,570,502 T195A probably damaging Het
Krt36 A T 11: 100,105,509 S30T probably benign Het
Lrp1 A G 10: 127,555,056 F2991L probably benign Het
Lrrc34 T A 3: 30,634,600 Q184L possibly damaging Het
Mapk1 A T 16: 17,035,462 M49L probably benign Het
Mroh2a G T 1: 88,235,216 Q360H probably benign Het
Mrpl48 A G 7: 100,546,367 probably benign Het
Ncln A G 10: 81,487,678 probably null Het
Nol4 T A 18: 22,920,825 Q96L probably damaging Het
Olfr1002 G A 2: 85,647,973 A116V probably damaging Het
Olfr1391 G T 11: 49,327,860 V150L probably benign Het
Padi2 A G 4: 140,946,766 probably null Het
Pak7 T G 2: 136,097,581 I545L possibly damaging Het
Paqr5 T A 9: 61,968,782 R157W probably null Het
Pard3b G A 1: 62,161,181 R293H probably damaging Het
Phf11d C A 14: 59,356,395 C110F probably damaging Het
Pkn2 G A 3: 142,799,004 P804S probably damaging Het
Pnpla6 G A 8: 3,534,611 C743Y possibly damaging Het
Pramef17 A G 4: 143,993,081 V238A probably benign Het
Psip1 A G 4: 83,468,642 M164T probably benign Het
Rgs22 C G 15: 36,048,764 S914T probably damaging Het
Rufy4 G A 1: 74,133,047 V310I probably benign Het
Ryr2 G A 13: 11,726,930 L2122F probably damaging Het
Sgcb T G 5: 73,640,693 N142T probably benign Het
Slc27a6 A G 18: 58,605,054 E394G probably benign Het
Slc29a2 T C 19: 5,029,243 V298A probably damaging Het
Slf2 C A 19: 44,943,468 T654N probably damaging Het
Spata4 A C 8: 54,602,333 K123Q possibly damaging Het
Taar7b T C 10: 24,000,858 V307A probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ttn T C 2: 76,863,639 E295G possibly damaging Het
Ubqln4 A T 3: 88,555,372 Q48L possibly damaging Het
Ugt1a10 T A 1: 88,055,925 D148E probably damaging Het
Vmn2r85 T A 10: 130,425,926 N181Y probably benign Het
Wdfy3 C T 5: 101,923,947 V1026I possibly damaging Het
Other mutations in Dlgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Dlgap2 APN 8 14778301 nonsense probably null
IGL01788:Dlgap2 APN 8 14843631 missense probably benign 0.19
IGL02054:Dlgap2 APN 8 14843552 missense probably damaging 0.98
IGL02969:Dlgap2 APN 8 14831579 missense possibly damaging 0.95
IGL03183:Dlgap2 APN 8 14727525 missense possibly damaging 0.62
IGL03303:Dlgap2 APN 8 14727812 missense probably damaging 0.99
PIT4403001:Dlgap2 UTSW 8 14831528 missense probably damaging 1.00
R0026:Dlgap2 UTSW 8 14727363 nonsense probably null
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0647:Dlgap2 UTSW 8 14727591 missense possibly damaging 0.95
R1221:Dlgap2 UTSW 8 14726952 missense probably benign 0.08
R1374:Dlgap2 UTSW 8 14831228 splice site probably benign
R1440:Dlgap2 UTSW 8 14727060 missense probably benign
R1544:Dlgap2 UTSW 8 14829861 splice site probably null
R1550:Dlgap2 UTSW 8 14822499 missense probably damaging 0.98
R1804:Dlgap2 UTSW 8 14727809 missense possibly damaging 0.71
R1870:Dlgap2 UTSW 8 14773347 missense probably damaging 1.00
R1921:Dlgap2 UTSW 8 14843624 missense probably benign 0.10
R2119:Dlgap2 UTSW 8 14778206 missense possibly damaging 0.69
R2193:Dlgap2 UTSW 8 14743431 missense possibly damaging 0.51
R4381:Dlgap2 UTSW 8 14846502 missense probably benign
R4422:Dlgap2 UTSW 8 14743463 critical splice donor site probably null
R4521:Dlgap2 UTSW 8 14727871 missense probably damaging 1.00
R4581:Dlgap2 UTSW 8 14846679 missense probably damaging 1.00
R4585:Dlgap2 UTSW 8 14727999 critical splice donor site probably null
R4760:Dlgap2 UTSW 8 14773380 missense probably damaging 1.00
R5077:Dlgap2 UTSW 8 14822691 missense probably benign 0.35
R5373:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5374:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5552:Dlgap2 UTSW 8 14831342 nonsense probably null
R5964:Dlgap2 UTSW 8 14727128 nonsense probably null
R6125:Dlgap2 UTSW 8 14727193 missense possibly damaging 0.78
R6147:Dlgap2 UTSW 8 14727294 missense probably benign 0.05
R6163:Dlgap2 UTSW 8 14846641 missense probably damaging 1.00
R6269:Dlgap2 UTSW 8 14822369 missense probably benign 0.01
R6629:Dlgap2 UTSW 8 14831465 missense probably benign 0.00
R6765:Dlgap2 UTSW 8 14743284 missense probably benign 0.00
R6913:Dlgap2 UTSW 8 14778374 missense probably benign 0.10
R7219:Dlgap2 UTSW 8 14743296 missense probably benign 0.00
R7485:Dlgap2 UTSW 8 14829952 missense probably damaging 0.97
R7560:Dlgap2 UTSW 8 14822697 critical splice donor site probably null
R7826:Dlgap2 UTSW 8 14743410 missense probably benign 0.38
X0060:Dlgap2 UTSW 8 14839787 missense probably damaging 1.00
Z1088:Dlgap2 UTSW 8 14822472 missense probably benign 0.10
Z1177:Dlgap2 UTSW 8 14727659 missense not run
Predicted Primers PCR Primer
(F):5'- CAATGGTGCATGCTGTGTGC -3'
(R):5'- CTTGACCGGCTGAATTTTAAGC -3'

Sequencing Primer
(F):5'- AGTGTGGCAAGTCCCTATTGC -3'
(R):5'- GACCGGCTGAATTTTAAGCTATCAC -3'
Posted On2018-09-12