Incidental Mutation 'R6809:Paqr5'
ID533711
Institutional Source Beutler Lab
Gene Symbol Paqr5
Ensembl Gene ENSMUSG00000032278
Gene Nameprogestin and adipoQ receptor family member V
Synonyms0610010I15Rik, mPRg
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R6809 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location61953481-62026856 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61968782 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 157 (R157W)
Ref Sequence ENSEMBL: ENSMUSP00000109623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034817] [ENSMUST00000113990]
Predicted Effect probably null
Transcript: ENSMUST00000034817
AA Change: R171W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034817
Gene: ENSMUSG00000032278
AA Change: R171W

DomainStartEndE-ValueType
Pfam:HlyIII 43 269 1.6e-59 PFAM
transmembrane domain 295 317 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113990
AA Change: R157W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109623
Gene: ENSMUSG00000032278
AA Change: R157W

DomainStartEndE-ValueType
Pfam:HlyIII 29 255 6.4e-51 PFAM
transmembrane domain 281 303 N/A INTRINSIC
Meta Mutation Damage Score 0.7935 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,874,282 N61S probably damaging Het
A130010J15Rik T A 1: 193,174,781 V147E possibly damaging Het
Adgrv1 A T 13: 81,472,953 M3893K probably benign Het
Aox3 T C 1: 58,118,681 S66P probably damaging Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Bloc1s5 A G 13: 38,603,985 V141A probably benign Het
Btbd11 A G 10: 85,631,376 T732A probably benign Het
Col28a1 T C 6: 7,999,468 Y1083C probably damaging Het
Crb1 A G 1: 139,243,126 V842A probably benign Het
Dapk1 A G 13: 60,751,289 S858G probably benign Het
Dlgap2 G T 8: 14,179,619 probably benign Het
Dpysl4 A G 7: 139,093,660 D199G probably benign Het
Eml6 C T 11: 29,803,161 V917I probably benign Het
Fut9 T A 4: 25,620,647 T56S probably benign Het
Gm6205 C A 5: 94,683,418 Q95K probably benign Het
Gtdc1 G C 2: 44,575,551 S214* probably null Het
Gtdc1 A G 2: 44,825,384 F49S probably damaging Het
Hoxd9 A G 2: 74,699,246 Y282C probably damaging Het
Hrc A G 7: 45,336,379 E318G probably benign Het
Ikzf2 T C 1: 69,570,502 T195A probably damaging Het
Krt36 A T 11: 100,105,509 S30T probably benign Het
Lrp1 A G 10: 127,555,056 F2991L probably benign Het
Lrrc34 T A 3: 30,634,600 Q184L possibly damaging Het
Mapk1 A T 16: 17,035,462 M49L probably benign Het
Mroh2a G T 1: 88,235,216 Q360H probably benign Het
Mrpl48 A G 7: 100,546,367 probably benign Het
Ncln A G 10: 81,487,678 probably null Het
Nol4 T A 18: 22,920,825 Q96L probably damaging Het
Olfr1002 G A 2: 85,647,973 A116V probably damaging Het
Olfr1391 G T 11: 49,327,860 V150L probably benign Het
Padi2 A G 4: 140,946,766 probably null Het
Pak7 T G 2: 136,097,581 I545L possibly damaging Het
Pard3b G A 1: 62,161,181 R293H probably damaging Het
Phf11d C A 14: 59,356,395 C110F probably damaging Het
Pkn2 G A 3: 142,799,004 P804S probably damaging Het
Pnpla6 G A 8: 3,534,611 C743Y possibly damaging Het
Pramef17 A G 4: 143,993,081 V238A probably benign Het
Psip1 A G 4: 83,468,642 M164T probably benign Het
Rgs22 C G 15: 36,048,764 S914T probably damaging Het
Rufy4 G A 1: 74,133,047 V310I probably benign Het
Ryr2 G A 13: 11,726,930 L2122F probably damaging Het
Sgcb T G 5: 73,640,693 N142T probably benign Het
Slc27a6 A G 18: 58,605,054 E394G probably benign Het
Slc29a2 T C 19: 5,029,243 V298A probably damaging Het
Slf2 C A 19: 44,943,468 T654N probably damaging Het
Spata4 A C 8: 54,602,333 K123Q possibly damaging Het
Taar7b T C 10: 24,000,858 V307A probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ttn T C 2: 76,863,639 E295G possibly damaging Het
Ubqln4 A T 3: 88,555,372 Q48L possibly damaging Het
Ugt1a10 T A 1: 88,055,925 D148E probably damaging Het
Vmn2r85 T A 10: 130,425,926 N181Y probably benign Het
Wdfy3 C T 5: 101,923,947 V1026I possibly damaging Het
Other mutations in Paqr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02893:Paqr5 APN 9 61968868 missense probably benign 0.00
IGL03190:Paqr5 APN 9 61972802 missense probably damaging 0.97
PIT4480001:Paqr5 UTSW 9 61956156 missense probably benign 0.09
R0528:Paqr5 UTSW 9 61956245 missense probably damaging 1.00
R0686:Paqr5 UTSW 9 61972794 missense probably benign 0.00
R0688:Paqr5 UTSW 9 61972794 missense probably benign 0.00
R1323:Paqr5 UTSW 9 61961528 critical splice donor site probably null
R1323:Paqr5 UTSW 9 61961528 critical splice donor site probably null
R2872:Paqr5 UTSW 9 61968779 critical splice donor site probably null
R2872:Paqr5 UTSW 9 61968779 critical splice donor site probably null
R5663:Paqr5 UTSW 9 61968862 missense probably benign 0.03
R6726:Paqr5 UTSW 9 61963783 missense probably damaging 1.00
R6728:Paqr5 UTSW 9 61963783 missense probably damaging 1.00
R6795:Paqr5 UTSW 9 61963783 missense probably damaging 1.00
R6796:Paqr5 UTSW 9 61963783 missense probably damaging 1.00
R6857:Paqr5 UTSW 9 61976088 missense probably damaging 1.00
R6967:Paqr5 UTSW 9 61972831 nonsense probably null
R7456:Paqr5 UTSW 9 61972790 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GATAGAATCTAGAGTCACCATGGAG -3'
(R):5'- CTGTGGCCTGGCTGCATC -3'

Sequencing Primer
(F):5'- TGACATCACACTGTAGGCTG -3'
(R):5'- TGGCTGCATCTCAAGGCTAG -3'
Posted On2018-09-12