Incidental Mutation 'R6810:Aox3'
ID533734
Institutional Source Beutler Lab
Gene Symbol Aox3
Ensembl Gene ENSMUSG00000064294
Gene Namealdehyde oxidase 3
SynonymsAOH1, 1200011D03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6810 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location58113130-58200698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58141431 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 250 (N250K)
Ref Sequence ENSEMBL: ENSMUSP00000049391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040999] [ENSMUST00000162011]
PDB Structure
Crystal structure of the mouse liver Aldehyde Oxidase 3 (mAOX3) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000040999
AA Change: N250K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000049391
Gene: ENSMUSG00000064294
AA Change: N250K

DomainStartEndE-ValueType
Pfam:Fer2 12 82 1.4e-9 PFAM
Pfam:Fer2_2 91 165 1e-29 PFAM
Pfam:FAD_binding_5 239 419 1e-44 PFAM
CO_deh_flav_C 426 530 9.26e-24 SMART
Ald_Xan_dh_C 594 697 2.27e-41 SMART
Pfam:Ald_Xan_dh_C2 708 1241 8.7e-183 PFAM
low complexity region 1275 1286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162011
SMART Domains Protein: ENSMUSP00000140140
Gene: ENSMUSG00000064294

DomainStartEndE-ValueType
Pfam:Fer2 12 82 3.6e-8 PFAM
Pfam:Fer2_2 91 166 2.5e-29 PFAM
transmembrane domain 242 264 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik C T 10: 22,066,717 G455R probably damaging Het
Adgrg5 A T 8: 94,933,942 T70S probably damaging Het
Adora1 T C 1: 134,234,039 Y106C probably damaging Het
Ap2b1 A T 11: 83,335,491 Y238F possibly damaging Het
Birc6 G A 17: 74,612,220 S2015N possibly damaging Het
C7 A G 15: 5,007,654 F581L probably damaging Het
Cd27 A T 6: 125,233,664 H203Q probably damaging Het
Cdk2 A G 10: 128,699,587 V274A probably benign Het
Cenpe A G 3: 135,243,822 T1351A probably benign Het
Chd7 T C 4: 8,839,523 L1353P probably damaging Het
Dcc C T 18: 71,370,693 V945M probably damaging Het
Dio1 A G 4: 107,297,725 V118A probably damaging Het
Dst C T 1: 34,212,298 T1818M probably damaging Het
Dthd1 T A 5: 62,814,329 M165K probably benign Het
Eif5b A G 1: 38,046,660 I929V probably benign Het
F5 T A 1: 164,186,902 S581T probably damaging Het
Fanca A C 8: 123,286,477 I761S probably damaging Het
Fat2 T C 11: 55,282,241 T2549A possibly damaging Het
Fut2 A G 7: 45,650,505 L281P probably damaging Het
Gm19410 C A 8: 35,772,579 A143E probably damaging Het
Gm5431 T C 11: 48,888,976 D651G probably damaging Het
Hook3 A C 8: 26,032,422 probably null Het
Ivd G T 2: 118,869,761 V90L probably benign Het
Klhdc7b A G 15: 89,388,356 Y1147C possibly damaging Het
Mlh1 G A 9: 111,241,558 T363M possibly damaging Het
Ndufa3 A T 7: 3,619,477 I45F probably damaging Het
Nell2 T C 15: 95,241,587 D588G probably damaging Het
Nhlrc3 T C 3: 53,453,575 N253S probably benign Het
Nlrp4c T A 7: 6,066,755 F552I probably damaging Het
Olfr1052 G A 2: 86,297,923 A36T probably benign Het
Olfr578 A C 7: 102,984,835 S110A probably damaging Het
Pcdhga12 T C 18: 37,767,179 S355P probably benign Het
Pcdhga7 A T 18: 37,715,873 Y311F probably benign Het
Phldb2 A G 16: 45,748,725 probably null Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Plxna4 A G 6: 32,310,522 V480A probably benign Het
Psrc1 A T 3: 108,385,348 K152N possibly damaging Het
Ptcd3 A C 6: 71,885,532 V473G probably damaging Het
Rab11fip1 ACTCT ACT 8: 27,152,732 probably null Het
Skint6 T C 4: 112,948,380 probably null Het
Slc24a1 A G 9: 64,948,323 V434A probably benign Het
Snd1 T A 6: 28,668,610 V432E probably benign Het
Syne2 C T 12: 75,942,885 T1847M probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tes C A 6: 17,104,652 N377K probably benign Het
Tfip11 T A 5: 112,333,597 I452N probably benign Het
Tgfbi T C 13: 56,637,203 S658P probably benign Het
Tmx4 A C 2: 134,620,674 D112E probably damaging Het
Tnn G T 1: 160,104,842 D1367E probably damaging Het
Triobp A G 15: 78,966,615 N323S possibly damaging Het
Usp40 T C 1: 87,981,033 D582G probably benign Het
Vmn2r99 A G 17: 19,380,034 K440R probably benign Het
Zfp707 T A 15: 75,974,899 L193Q probably damaging Het
Zfp748 T C 13: 67,541,725 Y472C probably damaging Het
Other mutations in Aox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Aox3 APN 1 58169794 missense probably damaging 1.00
IGL01747:Aox3 APN 1 58159658 missense probably damaging 0.97
IGL01883:Aox3 APN 1 58138283 missense probably damaging 1.00
IGL01911:Aox3 APN 1 58152560 missense probably benign 0.04
IGL02017:Aox3 APN 1 58120992 missense probably damaging 1.00
IGL02120:Aox3 APN 1 58127650 missense probably benign 0.00
IGL02466:Aox3 APN 1 58158272 missense probably benign 0.28
IGL02545:Aox3 APN 1 58183486 missense probably damaging 1.00
IGL02572:Aox3 APN 1 58158367 missense probably damaging 1.00
IGL02746:Aox3 APN 1 58183542 missense possibly damaging 0.83
IGL02808:Aox3 APN 1 58142700 missense probably damaging 0.99
IGL02812:Aox3 APN 1 58165896 missense probably benign 0.00
IGL02982:Aox3 APN 1 58127687 missense probably benign 0.00
IGL03056:Aox3 APN 1 58159021 critical splice donor site probably null
IGL03182:Aox3 APN 1 58165887 missense probably benign 0.02
IGL03234:Aox3 APN 1 58152686 missense probably benign
IGL03374:Aox3 APN 1 58171848 missense probably damaging 1.00
amber UTSW 1 58171891 nonsense probably null
R0071:Aox3 UTSW 1 58171891 nonsense probably null
R0071:Aox3 UTSW 1 58171891 nonsense probably null
R0135:Aox3 UTSW 1 58125088 splice site probably benign
R0332:Aox3 UTSW 1 58142751 missense probably benign 0.00
R0626:Aox3 UTSW 1 58172299 missense possibly damaging 0.94
R1325:Aox3 UTSW 1 58176567 nonsense probably null
R1435:Aox3 UTSW 1 58163446 critical splice donor site probably null
R1438:Aox3 UTSW 1 58153178 missense probably benign
R1567:Aox3 UTSW 1 58194693 missense probably damaging 0.96
R1575:Aox3 UTSW 1 58152554 missense probably benign 0.04
R1759:Aox3 UTSW 1 58170646 splice site probably null
R1785:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R1786:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R1921:Aox3 UTSW 1 58180651 missense probably damaging 1.00
R1984:Aox3 UTSW 1 58153061 missense possibly damaging 0.88
R2012:Aox3 UTSW 1 58138232 missense probably benign 0.02
R2080:Aox3 UTSW 1 58186280 missense probably benign 0.06
R2121:Aox3 UTSW 1 58152549 splice site probably benign
R2126:Aox3 UTSW 1 58158216 missense probably benign 0.25
R2130:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2131:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2132:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2133:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2385:Aox3 UTSW 1 58138289 missense probably damaging 1.00
R2495:Aox3 UTSW 1 58188408 missense probably damaging 0.99
R4200:Aox3 UTSW 1 58188378 missense probably damaging 1.00
R4231:Aox3 UTSW 1 58114885 missense probably benign 0.12
R4591:Aox3 UTSW 1 58152656 missense probably damaging 0.99
R4627:Aox3 UTSW 1 58125035 missense probably damaging 0.98
R4831:Aox3 UTSW 1 58152566 missense probably damaging 0.97
R4864:Aox3 UTSW 1 58176487 missense probably damaging 1.00
R4976:Aox3 UTSW 1 58188524 critical splice donor site probably null
R5007:Aox3 UTSW 1 58163424 missense probably benign
R5119:Aox3 UTSW 1 58188524 critical splice donor site probably null
R5175:Aox3 UTSW 1 58172328 missense probably benign 0.01
R5360:Aox3 UTSW 1 58146508 missense probably damaging 1.00
R5784:Aox3 UTSW 1 58153499 missense probably benign 0.00
R6050:Aox3 UTSW 1 58180655 missense possibly damaging 0.93
R6056:Aox3 UTSW 1 58169859 missense probably damaging 1.00
R6162:Aox3 UTSW 1 58159731 missense possibly damaging 0.75
R6181:Aox3 UTSW 1 58158946 missense probably benign 0.03
R6374:Aox3 UTSW 1 58172161 missense probably benign 0.11
R6662:Aox3 UTSW 1 58118615 missense probably damaging 1.00
R6809:Aox3 UTSW 1 58118681 missense probably damaging 0.99
R6821:Aox3 UTSW 1 58150388 missense probably benign 0.04
R7039:Aox3 UTSW 1 58176555 missense probably damaging 1.00
R7116:Aox3 UTSW 1 58153530 missense probably benign 0.01
R7146:Aox3 UTSW 1 58158529 intron probably null
R7163:Aox3 UTSW 1 58119512 missense probably damaging 0.99
R7243:Aox3 UTSW 1 58138307 missense unknown
R7319:Aox3 UTSW 1 58152602 missense probably benign 0.04
R7423:Aox3 UTSW 1 58121069 missense possibly damaging 0.80
R7664:Aox3 UTSW 1 58119539 missense probably damaging 1.00
R7709:Aox3 UTSW 1 58180651 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTCCTTGTCCTTGCAGG -3'
(R):5'- CCTCCTGTAACCCGTGAATCTG -3'

Sequencing Primer
(F):5'- CCTTGTCCTTGCAGGTAAGAGTC -3'
(R):5'- AACCCGTGAATCTGCTTGTGAG -3'
Posted On2018-09-12