Incidental Mutation 'R6810:Ivd'
ID533740
Institutional Source Beutler Lab
Gene Symbol Ivd
Ensembl Gene ENSMUSG00000027332
Gene Nameisovaleryl coenzyme A dehydrogenase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6810 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location118861954-118882909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 118869761 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 90 (V90L)
Ref Sequence ENSEMBL: ENSMUSP00000028807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028807]
Predicted Effect probably benign
Transcript: ENSMUST00000028807
AA Change: V90L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028807
Gene: ENSMUSG00000027332
AA Change: V90L

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 44 158 9.4e-40 PFAM
Pfam:Acyl-CoA_dh_M 162 259 8.1e-31 PFAM
Pfam:Acyl-CoA_dh_1 271 419 2e-42 PFAM
Pfam:Acyl-CoA_dh_2 286 409 6.7e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik C T 10: 22,066,717 G455R probably damaging Het
Adgrg5 A T 8: 94,933,942 T70S probably damaging Het
Adora1 T C 1: 134,234,039 Y106C probably damaging Het
Aox3 T A 1: 58,141,431 N250K probably benign Het
Ap2b1 A T 11: 83,335,491 Y238F possibly damaging Het
Birc6 G A 17: 74,612,220 S2015N possibly damaging Het
C7 A G 15: 5,007,654 F581L probably damaging Het
Cd27 A T 6: 125,233,664 H203Q probably damaging Het
Cdk2 A G 10: 128,699,587 V274A probably benign Het
Cenpe A G 3: 135,243,822 T1351A probably benign Het
Chd7 T C 4: 8,839,523 L1353P probably damaging Het
Dcc C T 18: 71,370,693 V945M probably damaging Het
Dio1 A G 4: 107,297,725 V118A probably damaging Het
Dst C T 1: 34,212,298 T1818M probably damaging Het
Dthd1 T A 5: 62,814,329 M165K probably benign Het
Eif5b A G 1: 38,046,660 I929V probably benign Het
F5 T A 1: 164,186,902 S581T probably damaging Het
Fanca A C 8: 123,286,477 I761S probably damaging Het
Fat2 T C 11: 55,282,241 T2549A possibly damaging Het
Fut2 A G 7: 45,650,505 L281P probably damaging Het
Gm19410 C A 8: 35,772,579 A143E probably damaging Het
Gm5431 T C 11: 48,888,976 D651G probably damaging Het
Hook3 A C 8: 26,032,422 probably null Het
Klhdc7b A G 15: 89,388,356 Y1147C possibly damaging Het
Mlh1 G A 9: 111,241,558 T363M possibly damaging Het
Ndufa3 A T 7: 3,619,477 I45F probably damaging Het
Nell2 T C 15: 95,241,587 D588G probably damaging Het
Nhlrc3 T C 3: 53,453,575 N253S probably benign Het
Nlrp4c T A 7: 6,066,755 F552I probably damaging Het
Olfr1052 G A 2: 86,297,923 A36T probably benign Het
Olfr578 A C 7: 102,984,835 S110A probably damaging Het
Pcdhga12 T C 18: 37,767,179 S355P probably benign Het
Pcdhga7 A T 18: 37,715,873 Y311F probably benign Het
Phldb2 A G 16: 45,748,725 probably null Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Plxna4 A G 6: 32,310,522 V480A probably benign Het
Psrc1 A T 3: 108,385,348 K152N possibly damaging Het
Ptcd3 A C 6: 71,885,532 V473G probably damaging Het
Rab11fip1 ACTCT ACT 8: 27,152,732 probably null Het
Skint6 T C 4: 112,948,380 probably null Het
Slc24a1 A G 9: 64,948,323 V434A probably benign Het
Snd1 T A 6: 28,668,610 V432E probably benign Het
Syne2 C T 12: 75,942,885 T1847M probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tes C A 6: 17,104,652 N377K probably benign Het
Tfip11 T A 5: 112,333,597 I452N probably benign Het
Tgfbi T C 13: 56,637,203 S658P probably benign Het
Tmx4 A C 2: 134,620,674 D112E probably damaging Het
Tnn G T 1: 160,104,842 D1367E probably damaging Het
Triobp A G 15: 78,966,615 N323S possibly damaging Het
Usp40 T C 1: 87,981,033 D582G probably benign Het
Vmn2r99 A G 17: 19,380,034 K440R probably benign Het
Zfp707 T A 15: 75,974,899 L193Q probably damaging Het
Zfp748 T C 13: 67,541,725 Y472C probably damaging Het
Other mutations in Ivd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Ivd APN 2 118876902 missense probably benign 0.06
IGL01122:Ivd APN 2 118876880 splice site probably benign
IGL01634:Ivd APN 2 118876382 missense probably damaging 1.00
IGL02178:Ivd APN 2 118871434 missense probably benign 0.00
IGL02478:Ivd APN 2 118862091 missense probably benign 0.21
IGL03104:Ivd APN 2 118872903 missense probably benign 0.01
R1335:Ivd UTSW 2 118869442 missense probably benign 0.00
R1823:Ivd UTSW 2 118862034 missense probably benign 0.05
R2008:Ivd UTSW 2 118871500 missense probably benign 0.00
R3162:Ivd UTSW 2 118862169 critical splice donor site probably null
R3162:Ivd UTSW 2 118862169 critical splice donor site probably null
R5011:Ivd UTSW 2 118880465 missense probably damaging 1.00
R5013:Ivd UTSW 2 118880465 missense probably damaging 1.00
R5946:Ivd UTSW 2 118876889 missense possibly damaging 0.49
R7055:Ivd UTSW 2 118873249 missense probably damaging 0.99
R7131:Ivd UTSW 2 118869774 missense probably damaging 1.00
R7173:Ivd UTSW 2 118871389 missense probably damaging 1.00
R7302:Ivd UTSW 2 118871504 missense probably benign 0.04
R7490:Ivd UTSW 2 118876892 missense possibly damaging 0.94
R7583:Ivd UTSW 2 118862131 missense probably damaging 0.96
Z1176:Ivd UTSW 2 118876344 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TATGCCTAGAAAGATGGCCACTG -3'
(R):5'- ATTTTATAGCATAGCTTTGGGAACA -3'

Sequencing Primer
(F):5'- TAGAAAGATGGCCACTGTCTCCTG -3'
(R):5'- TGAGGTAGAGTCTCTCACTGAACC -3'
Posted On2018-09-12