Incidental Mutation 'R6810:Cenpe'
ID533744
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Namecentromere protein E
Synonyms312kDa, CENP-E, Kif10, N-7 kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6810 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location135212537-135273611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135243822 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1351 (T1351A)
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893] [ENSMUST00000197369]
Predicted Effect probably benign
Transcript: ENSMUST00000062893
AA Change: T1351A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: T1351A

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197369
AA Change: T123A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143435
Gene: ENSMUSG00000045328
AA Change: T123A

DomainStartEndE-ValueType
coiled coil region 2 49 N/A INTRINSIC
coiled coil region 85 172 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik C T 10: 22,066,717 G455R probably damaging Het
Adgrg5 A T 8: 94,933,942 T70S probably damaging Het
Adora1 T C 1: 134,234,039 Y106C probably damaging Het
Aox3 T A 1: 58,141,431 N250K probably benign Het
Ap2b1 A T 11: 83,335,491 Y238F possibly damaging Het
Birc6 G A 17: 74,612,220 S2015N possibly damaging Het
C7 A G 15: 5,007,654 F581L probably damaging Het
Cd27 A T 6: 125,233,664 H203Q probably damaging Het
Cdk2 A G 10: 128,699,587 V274A probably benign Het
Chd7 T C 4: 8,839,523 L1353P probably damaging Het
Dcc C T 18: 71,370,693 V945M probably damaging Het
Dio1 A G 4: 107,297,725 V118A probably damaging Het
Dst C T 1: 34,212,298 T1818M probably damaging Het
Dthd1 T A 5: 62,814,329 M165K probably benign Het
Eif5b A G 1: 38,046,660 I929V probably benign Het
F5 T A 1: 164,186,902 S581T probably damaging Het
Fanca A C 8: 123,286,477 I761S probably damaging Het
Fat2 T C 11: 55,282,241 T2549A possibly damaging Het
Fut2 A G 7: 45,650,505 L281P probably damaging Het
Gm19410 C A 8: 35,772,579 A143E probably damaging Het
Gm5431 T C 11: 48,888,976 D651G probably damaging Het
Hook3 A C 8: 26,032,422 probably null Het
Ivd G T 2: 118,869,761 V90L probably benign Het
Klhdc7b A G 15: 89,388,356 Y1147C possibly damaging Het
Mlh1 G A 9: 111,241,558 T363M possibly damaging Het
Ndufa3 A T 7: 3,619,477 I45F probably damaging Het
Nell2 T C 15: 95,241,587 D588G probably damaging Het
Nhlrc3 T C 3: 53,453,575 N253S probably benign Het
Nlrp4c T A 7: 6,066,755 F552I probably damaging Het
Olfr1052 G A 2: 86,297,923 A36T probably benign Het
Olfr578 A C 7: 102,984,835 S110A probably damaging Het
Pcdhga12 T C 18: 37,767,179 S355P probably benign Het
Pcdhga7 A T 18: 37,715,873 Y311F probably benign Het
Phldb2 A G 16: 45,748,725 probably null Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Plxna4 A G 6: 32,310,522 V480A probably benign Het
Psrc1 A T 3: 108,385,348 K152N possibly damaging Het
Ptcd3 A C 6: 71,885,532 V473G probably damaging Het
Rab11fip1 ACTCT ACT 8: 27,152,732 probably null Het
Skint6 T C 4: 112,948,380 probably null Het
Slc24a1 A G 9: 64,948,323 V434A probably benign Het
Snd1 T A 6: 28,668,610 V432E probably benign Het
Syne2 C T 12: 75,942,885 T1847M probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tes C A 6: 17,104,652 N377K probably benign Het
Tfip11 T A 5: 112,333,597 I452N probably benign Het
Tgfbi T C 13: 56,637,203 S658P probably benign Het
Tmx4 A C 2: 134,620,674 D112E probably damaging Het
Tnn G T 1: 160,104,842 D1367E probably damaging Het
Triobp A G 15: 78,966,615 N323S possibly damaging Het
Usp40 T C 1: 87,981,033 D582G probably benign Het
Vmn2r99 A G 17: 19,380,034 K440R probably benign Het
Zfp707 T A 15: 75,974,899 L193Q probably damaging Het
Zfp748 T C 13: 67,541,725 Y472C probably damaging Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 135231455 critical splice donor site probably null
IGL00799:Cenpe APN 3 135228917 critical splice donor site probably null
IGL00815:Cenpe APN 3 135259351 missense probably benign
IGL01446:Cenpe APN 3 135237539 missense probably benign 0.01
IGL01469:Cenpe APN 3 135228806 missense probably damaging 1.00
IGL01843:Cenpe APN 3 135218507 missense possibly damaging 0.88
IGL02254:Cenpe APN 3 135255477 missense probably benign
IGL02337:Cenpe APN 3 135220276 splice site probably benign
IGL02382:Cenpe APN 3 135247386 missense probably benign
IGL02458:Cenpe APN 3 135230108 nonsense probably null
IGL02934:Cenpe APN 3 135264351 missense probably damaging 1.00
IGL03335:Cenpe APN 3 135243625 missense probably benign
R0086:Cenpe UTSW 3 135264424 splice site probably benign
R0173:Cenpe UTSW 3 135259983 missense probably benign 0.00
R0394:Cenpe UTSW 3 135216425 splice site probably benign
R0411:Cenpe UTSW 3 135222255 missense probably damaging 1.00
R0624:Cenpe UTSW 3 135246586 missense probably benign 0.00
R0634:Cenpe UTSW 3 135246827 missense probably damaging 1.00
R0648:Cenpe UTSW 3 135230082 missense probably damaging 1.00
R0691:Cenpe UTSW 3 135217305 missense probably damaging 1.00
R1184:Cenpe UTSW 3 135264422 critical splice donor site probably null
R1530:Cenpe UTSW 3 135246902 missense possibly damaging 0.92
R1559:Cenpe UTSW 3 135270900 missense probably benign 0.07
R1562:Cenpe UTSW 3 135238394 missense possibly damaging 0.53
R1568:Cenpe UTSW 3 135239758 missense probably benign 0.01
R1712:Cenpe UTSW 3 135265933 missense probably damaging 0.99
R1828:Cenpe UTSW 3 135246496 missense probably damaging 0.99
R1846:Cenpe UTSW 3 135239845 missense probably damaging 1.00
R1861:Cenpe UTSW 3 135268979 missense probably damaging 1.00
R1938:Cenpe UTSW 3 135247479 missense probably damaging 0.98
R1961:Cenpe UTSW 3 135242493 missense probably damaging 1.00
R2062:Cenpe UTSW 3 135222321 splice site probably benign
R2118:Cenpe UTSW 3 135246884 missense possibly damaging 0.94
R2127:Cenpe UTSW 3 135239780 missense probably benign 0.08
R2156:Cenpe UTSW 3 135247474 missense probably benign 0.34
R2265:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2268:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2392:Cenpe UTSW 3 135248113 missense probably damaging 1.00
R2508:Cenpe UTSW 3 135241073 missense possibly damaging 0.92
R3084:Cenpe UTSW 3 135241021 missense probably damaging 1.00
R3779:Cenpe UTSW 3 135256576 missense possibly damaging 0.87
R3833:Cenpe UTSW 3 135222322 splice site probably benign
R3974:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135238472 critical splice donor site probably null
R4151:Cenpe UTSW 3 135215153 missense probably benign 0.36
R4166:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R4581:Cenpe UTSW 3 135247000 missense probably benign 0.30
R4622:Cenpe UTSW 3 135243708 missense probably benign 0.22
R4692:Cenpe UTSW 3 135216379 missense probably benign 0.29
R4769:Cenpe UTSW 3 135248151 missense probably benign
R4976:Cenpe UTSW 3 135234876 missense probably damaging 1.00
R4983:Cenpe UTSW 3 135234928 missense probably damaging 1.00
R4990:Cenpe UTSW 3 135256640 missense probably damaging 1.00
R5002:Cenpe UTSW 3 135247081 missense probably benign
R5057:Cenpe UTSW 3 135220313 missense probably benign 0.14
R5063:Cenpe UTSW 3 135270954 missense probably damaging 0.99
R5181:Cenpe UTSW 3 135242303 missense probably damaging 0.99
R5281:Cenpe UTSW 3 135230150 missense possibly damaging 0.89
R5389:Cenpe UTSW 3 135259388 critical splice donor site probably null
R5517:Cenpe UTSW 3 135223265 missense probably damaging 1.00
R5521:Cenpe UTSW 3 135269065 missense probably damaging 1.00
R5607:Cenpe UTSW 3 135235076 nonsense probably null
R5608:Cenpe UTSW 3 135235076 nonsense probably null
R5627:Cenpe UTSW 3 135235473 missense possibly damaging 0.51
R5766:Cenpe UTSW 3 135248413 missense probably damaging 0.96
R5783:Cenpe UTSW 3 135261580 missense probably benign 0.00
R5933:Cenpe UTSW 3 135261628 missense probably benign 0.03
R6073:Cenpe UTSW 3 135260073 nonsense probably null
R6163:Cenpe UTSW 3 135269003 missense probably damaging 0.99
R6192:Cenpe UTSW 3 135248530 missense possibly damaging 0.93
R6224:Cenpe UTSW 3 135243775 missense possibly damaging 0.87
R6313:Cenpe UTSW 3 135230175 missense probably benign 0.26
R6326:Cenpe UTSW 3 135239778 missense probably benign 0.15
R6383:Cenpe UTSW 3 135251528 missense probably damaging 1.00
R6418:Cenpe UTSW 3 135251544 missense probably damaging 0.99
R6797:Cenpe UTSW 3 135238138 missense possibly damaging 0.92
R6989:Cenpe UTSW 3 135235127 missense probably damaging 1.00
R7009:Cenpe UTSW 3 135235201 missense probably damaging 0.97
R7009:Cenpe UTSW 3 135235202 missense probably benign 0.02
R7039:Cenpe UTSW 3 135255456 missense probably benign 0.28
R7387:Cenpe UTSW 3 135247037 missense probably benign 0.05
R7470:Cenpe UTSW 3 135242155 missense probably damaging 1.00
R7535:Cenpe UTSW 3 135243762 missense possibly damaging 0.90
R7562:Cenpe UTSW 3 135248634 missense probably damaging 1.00
R7573:Cenpe UTSW 3 135247459 missense probably damaging 1.00
R7613:Cenpe UTSW 3 135242302 missense possibly damaging 0.90
R7741:Cenpe UTSW 3 135247335 splice site probably null
R7771:Cenpe UTSW 3 135240941 splice site probably null
R7843:Cenpe UTSW 3 135232959 nonsense probably null
R7926:Cenpe UTSW 3 135232959 nonsense probably null
R8036:Cenpe UTSW 3 135239848 frame shift probably null
R8069:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R8151:Cenpe UTSW 3 135247022 missense probably benign 0.28
R8176:Cenpe UTSW 3 135230090 missense probably damaging 1.00
R8191:Cenpe UTSW 3 135251614 missense probably benign
R8251:Cenpe UTSW 3 135251684 critical splice donor site probably null
Z1177:Cenpe UTSW 3 135216385 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCCTGTTGTCAAAGAAGCCAGG -3'
(R):5'- GTGAGATTTTAACTGTGACACAAGC -3'

Sequencing Primer
(F):5'- TTGTCAAAGAAGCCAGGCACAG -3'
(R):5'- TTAATCCCAGCGCTTGAGAG -3'
Posted On2018-09-12