Incidental Mutation 'R6810:Fut2'
ID533757
Institutional Source Beutler Lab
Gene Symbol Fut2
Ensembl Gene ENSMUSG00000055978
Gene Namefucosyltransferase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6810 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45648591-45666394 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45650505 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 281 (L281P)
Ref Sequence ENSEMBL: ENSMUSP00000063719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069800] [ENSMUST00000210620]
Predicted Effect probably damaging
Transcript: ENSMUST00000069800
AA Change: L281P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063719
Gene: ENSMUSG00000055978
AA Change: L281P

DomainStartEndE-ValueType
Pfam:Glyco_transf_11 21 338 2.1e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210620
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is involved in the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene results in altered glycosylation of gastric mucosa and uterine epithelia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. Females are somewhate more susceptible to infections withCandida albicans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik C T 10: 22,066,717 G455R probably damaging Het
Adgrg5 A T 8: 94,933,942 T70S probably damaging Het
Adora1 T C 1: 134,234,039 Y106C probably damaging Het
Aox3 T A 1: 58,141,431 N250K probably benign Het
Ap2b1 A T 11: 83,335,491 Y238F possibly damaging Het
Birc6 G A 17: 74,612,220 S2015N possibly damaging Het
C7 A G 15: 5,007,654 F581L probably damaging Het
Cd27 A T 6: 125,233,664 H203Q probably damaging Het
Cdk2 A G 10: 128,699,587 V274A probably benign Het
Cenpe A G 3: 135,243,822 T1351A probably benign Het
Chd7 T C 4: 8,839,523 L1353P probably damaging Het
Dcc C T 18: 71,370,693 V945M probably damaging Het
Dio1 A G 4: 107,297,725 V118A probably damaging Het
Dst C T 1: 34,212,298 T1818M probably damaging Het
Dthd1 T A 5: 62,814,329 M165K probably benign Het
Eif5b A G 1: 38,046,660 I929V probably benign Het
F5 T A 1: 164,186,902 S581T probably damaging Het
Fanca A C 8: 123,286,477 I761S probably damaging Het
Fat2 T C 11: 55,282,241 T2549A possibly damaging Het
Gm19410 C A 8: 35,772,579 A143E probably damaging Het
Gm5431 T C 11: 48,888,976 D651G probably damaging Het
Hook3 A C 8: 26,032,422 probably null Het
Ivd G T 2: 118,869,761 V90L probably benign Het
Klhdc7b A G 15: 89,388,356 Y1147C possibly damaging Het
Mlh1 G A 9: 111,241,558 T363M possibly damaging Het
Ndufa3 A T 7: 3,619,477 I45F probably damaging Het
Nell2 T C 15: 95,241,587 D588G probably damaging Het
Nhlrc3 T C 3: 53,453,575 N253S probably benign Het
Nlrp4c T A 7: 6,066,755 F552I probably damaging Het
Olfr1052 G A 2: 86,297,923 A36T probably benign Het
Olfr578 A C 7: 102,984,835 S110A probably damaging Het
Pcdhga12 T C 18: 37,767,179 S355P probably benign Het
Pcdhga7 A T 18: 37,715,873 Y311F probably benign Het
Phldb2 A G 16: 45,748,725 probably null Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Plxna4 A G 6: 32,310,522 V480A probably benign Het
Psrc1 A T 3: 108,385,348 K152N possibly damaging Het
Ptcd3 A C 6: 71,885,532 V473G probably damaging Het
Rab11fip1 ACTCT ACT 8: 27,152,732 probably null Het
Skint6 T C 4: 112,948,380 probably null Het
Slc24a1 A G 9: 64,948,323 V434A probably benign Het
Snd1 T A 6: 28,668,610 V432E probably benign Het
Syne2 C T 12: 75,942,885 T1847M probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tes C A 6: 17,104,652 N377K probably benign Het
Tfip11 T A 5: 112,333,597 I452N probably benign Het
Tgfbi T C 13: 56,637,203 S658P probably benign Het
Tmx4 A C 2: 134,620,674 D112E probably damaging Het
Tnn G T 1: 160,104,842 D1367E probably damaging Het
Triobp A G 15: 78,966,615 N323S possibly damaging Het
Usp40 T C 1: 87,981,033 D582G probably benign Het
Vmn2r99 A G 17: 19,380,034 K440R probably benign Het
Zfp707 T A 15: 75,974,899 L193Q probably damaging Het
Zfp748 T C 13: 67,541,725 Y472C probably damaging Het
Other mutations in Fut2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02814:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL02831:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL02982:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03071:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03090:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03126:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03146:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03151:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03179:Fut2 APN 7 45650649 missense probably benign 0.02
IGL03212:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03213:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03234:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03271:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03372:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03381:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03385:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03392:Fut2 APN 7 45650769 missense possibly damaging 0.94
PIT4515001:Fut2 UTSW 7 45650466 missense probably damaging 1.00
R0553:Fut2 UTSW 7 45651274 missense probably damaging 1.00
R1895:Fut2 UTSW 7 45651324 missense probably damaging 1.00
R1946:Fut2 UTSW 7 45651324 missense probably damaging 1.00
R2347:Fut2 UTSW 7 45650328 missense probably damaging 0.99
R3155:Fut2 UTSW 7 45650667 missense probably damaging 1.00
R3156:Fut2 UTSW 7 45650667 missense probably damaging 1.00
R4590:Fut2 UTSW 7 45650946 missense possibly damaging 0.64
R6311:Fut2 UTSW 7 45650380 missense possibly damaging 0.46
R6965:Fut2 UTSW 7 45650881 missense probably damaging 1.00
R8135:Fut2 UTSW 7 45651142 missense probably damaging 1.00
X0066:Fut2 UTSW 7 45650374 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCTTGAGATGGAAATGGGAC -3'
(R):5'- TGACCGGGGTTACCTAGAAAAG -3'

Sequencing Primer
(F):5'- CCAAGGACAGGCTGGTTGTTAG -3'
(R):5'- CCTAGAAAAGGCCCTGGACAG -3'
Posted On2018-09-12