Incidental Mutation 'R6810:Fut2'
ID 533757
Institutional Source Beutler Lab
Gene Symbol Fut2
Ensembl Gene ENSMUSG00000055978
Gene Name fucosyltransferase 2
Synonyms
MMRRC Submission 044923-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6810 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 45298015-45315818 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45299929 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 281 (L281P)
Ref Sequence ENSEMBL: ENSMUSP00000063719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069800] [ENSMUST00000210620]
AlphaFold Q9JL27
Predicted Effect probably damaging
Transcript: ENSMUST00000069800
AA Change: L281P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063719
Gene: ENSMUSG00000055978
AA Change: L281P

DomainStartEndE-ValueType
Pfam:Glyco_transf_11 21 338 2.1e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210620
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is involved in the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene results in altered glycosylation of gastric mucosa and uterine epithelia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. Females are somewhate more susceptible to infections withCandida albicans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg5 A T 8: 95,660,570 (GRCm39) T70S probably damaging Het
Adora1 T C 1: 134,161,777 (GRCm39) Y106C probably damaging Het
Aox3 T A 1: 58,180,590 (GRCm39) N250K probably benign Het
Ap2b1 A T 11: 83,226,317 (GRCm39) Y238F possibly damaging Het
Birc6 G A 17: 74,919,215 (GRCm39) S2015N possibly damaging Het
C7 A G 15: 5,037,136 (GRCm39) F581L probably damaging Het
Cd27 A T 6: 125,210,627 (GRCm39) H203Q probably damaging Het
Cdk2 A G 10: 128,535,456 (GRCm39) V274A probably benign Het
Cenpe A G 3: 134,949,583 (GRCm39) T1351A probably benign Het
Chd7 T C 4: 8,839,523 (GRCm39) L1353P probably damaging Het
Dcc C T 18: 71,503,764 (GRCm39) V945M probably damaging Het
Dio1 A G 4: 107,154,922 (GRCm39) V118A probably damaging Het
Dst C T 1: 34,251,379 (GRCm39) T1818M probably damaging Het
Dthd1 T A 5: 62,971,672 (GRCm39) M165K probably benign Het
Eif5b A G 1: 38,085,741 (GRCm39) I929V probably benign Het
F5 T A 1: 164,014,471 (GRCm39) S581T probably damaging Het
Fanca A C 8: 124,013,216 (GRCm39) I761S probably damaging Het
Fat2 T C 11: 55,173,067 (GRCm39) T2549A possibly damaging Het
Gm19410 C A 8: 36,239,733 (GRCm39) A143E probably damaging Het
Gm5431 T C 11: 48,779,803 (GRCm39) D651G probably damaging Het
Hook3 A C 8: 26,522,450 (GRCm39) probably null Het
Ivd G T 2: 118,700,242 (GRCm39) V90L probably benign Het
Klhdc7b A G 15: 89,272,559 (GRCm39) Y1147C possibly damaging Het
Mlh1 G A 9: 111,070,626 (GRCm39) T363M possibly damaging Het
Ndufa3 A T 7: 3,622,476 (GRCm39) I45F probably damaging Het
Nell2 T C 15: 95,139,468 (GRCm39) D588G probably damaging Het
Nhlrc3 T C 3: 53,360,996 (GRCm39) N253S probably benign Het
Nlrp4c T A 7: 6,069,754 (GRCm39) F552I probably damaging Het
Or51g1 A C 7: 102,634,042 (GRCm39) S110A probably damaging Het
Or5j3 G A 2: 86,128,267 (GRCm39) A36T probably benign Het
Pcdhga12 T C 18: 37,900,232 (GRCm39) S355P probably benign Het
Pcdhga7 A T 18: 37,848,926 (GRCm39) Y311F probably benign Het
Phldb2 A G 16: 45,569,088 (GRCm39) probably null Het
Plscr4 G A 9: 92,365,889 (GRCm39) V120I probably damaging Het
Plxna4 A G 6: 32,287,457 (GRCm39) V480A probably benign Het
Psrc1 A T 3: 108,292,664 (GRCm39) K152N possibly damaging Het
Ptcd3 A C 6: 71,862,516 (GRCm39) V473G probably damaging Het
Rab11fip1 ACTCT ACT 8: 27,642,760 (GRCm39) probably null Het
Semp2l2b C T 10: 21,942,616 (GRCm39) G455R probably damaging Het
Skint6 T C 4: 112,805,577 (GRCm39) probably null Het
Slc24a1 A G 9: 64,855,605 (GRCm39) V434A probably benign Het
Snd1 T A 6: 28,668,609 (GRCm39) V432E probably benign Het
Syne2 C T 12: 75,989,659 (GRCm39) T1847M probably benign Het
Tenm4 G A 7: 96,202,703 (GRCm39) R106H probably benign Het
Tes C A 6: 17,104,651 (GRCm39) N377K probably benign Het
Tfip11 T A 5: 112,481,463 (GRCm39) I452N probably benign Het
Tgfbi T C 13: 56,785,016 (GRCm39) S658P probably benign Het
Tmx4 A C 2: 134,462,594 (GRCm39) D112E probably damaging Het
Tnn G T 1: 159,932,412 (GRCm39) D1367E probably damaging Het
Triobp A G 15: 78,850,815 (GRCm39) N323S possibly damaging Het
Usp40 T C 1: 87,908,755 (GRCm39) D582G probably benign Het
Vmn2r99 A G 17: 19,600,296 (GRCm39) K440R probably benign Het
Zfp707 T A 15: 75,846,748 (GRCm39) L193Q probably damaging Het
Zfp748 T C 13: 67,689,844 (GRCm39) Y472C probably damaging Het
Other mutations in Fut2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02814:Fut2 APN 7 45,300,193 (GRCm39) missense possibly damaging 0.94
IGL02831:Fut2 APN 7 45,300,193 (GRCm39) missense possibly damaging 0.94
IGL02982:Fut2 APN 7 45,300,193 (GRCm39) missense possibly damaging 0.94
IGL03071:Fut2 APN 7 45,300,193 (GRCm39) missense possibly damaging 0.94
IGL03090:Fut2 APN 7 45,300,193 (GRCm39) missense possibly damaging 0.94
IGL03126:Fut2 APN 7 45,300,193 (GRCm39) missense possibly damaging 0.94
IGL03146:Fut2 APN 7 45,300,193 (GRCm39) missense possibly damaging 0.94
IGL03151:Fut2 APN 7 45,300,193 (GRCm39) missense possibly damaging 0.94
IGL03179:Fut2 APN 7 45,300,073 (GRCm39) missense probably benign 0.02
IGL03212:Fut2 APN 7 45,300,193 (GRCm39) missense possibly damaging 0.94
IGL03213:Fut2 APN 7 45,300,193 (GRCm39) missense possibly damaging 0.94
IGL03234:Fut2 APN 7 45,300,193 (GRCm39) missense possibly damaging 0.94
IGL03271:Fut2 APN 7 45,300,193 (GRCm39) missense possibly damaging 0.94
IGL03372:Fut2 APN 7 45,300,193 (GRCm39) missense possibly damaging 0.94
IGL03381:Fut2 APN 7 45,300,193 (GRCm39) missense possibly damaging 0.94
IGL03385:Fut2 APN 7 45,300,193 (GRCm39) missense possibly damaging 0.94
IGL03392:Fut2 APN 7 45,300,193 (GRCm39) missense possibly damaging 0.94
PIT4515001:Fut2 UTSW 7 45,299,890 (GRCm39) missense probably damaging 1.00
R0553:Fut2 UTSW 7 45,300,698 (GRCm39) missense probably damaging 1.00
R1895:Fut2 UTSW 7 45,300,748 (GRCm39) missense probably damaging 1.00
R1946:Fut2 UTSW 7 45,300,748 (GRCm39) missense probably damaging 1.00
R2347:Fut2 UTSW 7 45,299,752 (GRCm39) missense probably damaging 0.99
R3155:Fut2 UTSW 7 45,300,091 (GRCm39) missense probably damaging 1.00
R3156:Fut2 UTSW 7 45,300,091 (GRCm39) missense probably damaging 1.00
R4590:Fut2 UTSW 7 45,300,370 (GRCm39) missense possibly damaging 0.64
R6311:Fut2 UTSW 7 45,299,804 (GRCm39) missense possibly damaging 0.46
R6965:Fut2 UTSW 7 45,300,305 (GRCm39) missense probably damaging 1.00
R8135:Fut2 UTSW 7 45,300,566 (GRCm39) missense probably damaging 1.00
R9087:Fut2 UTSW 7 45,300,493 (GRCm39) missense probably damaging 1.00
R9097:Fut2 UTSW 7 45,300,375 (GRCm39) missense probably benign 0.01
R9462:Fut2 UTSW 7 45,300,492 (GRCm39) missense probably damaging 1.00
X0066:Fut2 UTSW 7 45,299,798 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCTTGAGATGGAAATGGGAC -3'
(R):5'- TGACCGGGGTTACCTAGAAAAG -3'

Sequencing Primer
(F):5'- CCAAGGACAGGCTGGTTGTTAG -3'
(R):5'- CCTAGAAAAGGCCCTGGACAG -3'
Posted On 2018-09-12