Mutagenetix > Incidental Mutation

Incidental Mutation 'R6810:Fut2'

533757

Institutional Source

Beutler Lab

Gene Symbol

Fut2

Ensembl Gene

ENSMUSG00000055978

Gene Name

fucosyltransferase 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6810 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

45648591-45666394 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 45650505 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 281 (L281P)

Ref Sequence

ENSEMBL: ENSMUSP00000063719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069800] [ENSMUST00000210620]

AlphaFold

Q9JL27

Predicted Effect

probably damaging
Transcript: ENSMUST00000069800
AA Change: L281P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063719
Gene: ENSMUSG00000055978
AA Change: L281P

Domain	Start	End	E-Value	Type
Pfam:Glyco_transf_11	21	338	2.1e-139	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000210620

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.8%
20x: 96.7%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is involved in the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene results in altered glycosylation of gastric mucosa and uterine epithelia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. Females are somewhate more susceptible to infections withCandida albicans. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	C	T	10: 22,066,717	G455R	probably damaging	Het
Adgrg5	A	T	8: 94,933,942	T70S	probably damaging	Het
Adora1	T	C	1: 134,234,039	Y106C	probably damaging	Het
Aox3	T	A	1: 58,141,431	N250K	probably benign	Het
Ap2b1	A	T	11: 83,335,491	Y238F	possibly damaging	Het
Birc6	G	A	17: 74,612,220	S2015N	possibly damaging	Het
C7	A	G	15: 5,007,654	F581L	probably damaging	Het
Cd27	A	T	6: 125,233,664	H203Q	probably damaging	Het
Cdk2	A	G	10: 128,699,587	V274A	probably benign	Het
Cenpe	A	G	3: 135,243,822	T1351A	probably benign	Het
Chd7	T	C	4: 8,839,523	L1353P	probably damaging	Het
Dcc	C	T	18: 71,370,693	V945M	probably damaging	Het
Dio1	A	G	4: 107,297,725	V118A	probably damaging	Het
Dst	C	T	1: 34,212,298	T1818M	probably damaging	Het
Dthd1	T	A	5: 62,814,329	M165K	probably benign	Het
Eif5b	A	G	1: 38,046,660	I929V	probably benign	Het
F5	T	A	1: 164,186,902	S581T	probably damaging	Het
Fanca	A	C	8: 123,286,477	I761S	probably damaging	Het
Fat2	T	C	11: 55,282,241	T2549A	possibly damaging	Het
Gm19410	C	A	8: 35,772,579	A143E	probably damaging	Het
Gm5431	T	C	11: 48,888,976	D651G	probably damaging	Het
Hook3	A	C	8: 26,032,422		probably null	Het
Ivd	G	T	2: 118,869,761	V90L	probably benign	Het
Klhdc7b	A	G	15: 89,388,356	Y1147C	possibly damaging	Het
Mlh1	G	A	9: 111,241,558	T363M	possibly damaging	Het
Ndufa3	A	T	7: 3,619,477	I45F	probably damaging	Het
Nell2	T	C	15: 95,241,587	D588G	probably damaging	Het
Nhlrc3	T	C	3: 53,453,575	N253S	probably benign	Het
Nlrp4c	T	A	7: 6,066,755	F552I	probably damaging	Het
Olfr1052	G	A	2: 86,297,923	A36T	probably benign	Het
Olfr578	A	C	7: 102,984,835	S110A	probably damaging	Het
Pcdhga12	T	C	18: 37,767,179	S355P	probably benign	Het
Pcdhga7	A	T	18: 37,715,873	Y311F	probably benign	Het
Phldb2	A	G	16: 45,748,725		probably null	Het
Plscr4	G	A	9: 92,483,836	V120I	probably damaging	Het
Plxna4	A	G	6: 32,310,522	V480A	probably benign	Het
Psrc1	A	T	3: 108,385,348	K152N	possibly damaging	Het
Ptcd3	A	C	6: 71,885,532	V473G	probably damaging	Het
Rab11fip1	ACTCT	ACT	8: 27,152,732		probably null	Het
Skint6	T	C	4: 112,948,380		probably null	Het
Slc24a1	A	G	9: 64,948,323	V434A	probably benign	Het
Snd1	T	A	6: 28,668,610	V432E	probably benign	Het
Syne2	C	T	12: 75,942,885	T1847M	probably benign	Het
Tenm4	G	A	7: 96,553,496	R106H	probably benign	Het
Tes	C	A	6: 17,104,652	N377K	probably benign	Het
Tfip11	T	A	5: 112,333,597	I452N	probably benign	Het
Tgfbi	T	C	13: 56,637,203	S658P	probably benign	Het
Tmx4	A	C	2: 134,620,674	D112E	probably damaging	Het
Tnn	G	T	1: 160,104,842	D1367E	probably damaging	Het
Triobp	A	G	15: 78,966,615	N323S	possibly damaging	Het
Usp40	T	C	1: 87,981,033	D582G	probably benign	Het
Vmn2r99	A	G	17: 19,380,034	K440R	probably benign	Het
Zfp707	T	A	15: 75,974,899	L193Q	probably damaging	Het
Zfp748	T	C	13: 67,541,725	Y472C	probably damaging	Het

Other mutations in Fut2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02814:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL02831:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL02982:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03071:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03090:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03126:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03146:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03151:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03179:Fut2	APN	7	45650649	missense	probably benign	0.02
IGL03212:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03213:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03234:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03271:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03372:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03381:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03385:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03392:Fut2	APN	7	45650769	missense	possibly damaging	0.94
PIT4515001:Fut2	UTSW	7	45650466	missense	probably damaging	1.00
R0553:Fut2	UTSW	7	45651274	missense	probably damaging	1.00
R1895:Fut2	UTSW	7	45651324	missense	probably damaging	1.00
R1946:Fut2	UTSW	7	45651324	missense	probably damaging	1.00
R2347:Fut2	UTSW	7	45650328	missense	probably damaging	0.99
R3155:Fut2	UTSW	7	45650667	missense	probably damaging	1.00
R3156:Fut2	UTSW	7	45650667	missense	probably damaging	1.00
R4590:Fut2	UTSW	7	45650946	missense	possibly damaging	0.64
R6311:Fut2	UTSW	7	45650380	missense	possibly damaging	0.46
R6965:Fut2	UTSW	7	45650881	missense	probably damaging	1.00
R8135:Fut2	UTSW	7	45651142	missense	probably damaging	1.00
R9087:Fut2	UTSW	7	45651069	missense	probably damaging	1.00
R9097:Fut2	UTSW	7	45650951	missense	probably benign	0.01
R9462:Fut2	UTSW	7	45651068	missense	probably damaging	1.00
X0066:Fut2	UTSW	7	45650374	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCCTTGAGATGGAAATGGGAC -3'
(R):5'- TGACCGGGGTTACCTAGAAAAG -3'

Sequencing Primer
(F):5'- CCAAGGACAGGCTGGTTGTTAG -3'
(R):5'- CCTAGAAAAGGCCCTGGACAG -3'

Posted On

2018-09-12