Incidental Mutation 'R6810:Olfr578'
ID533759
Institutional Source Beutler Lab
Gene Symbol Olfr578
Ensembl Gene ENSMUSG00000045792
Gene Nameolfactory receptor 578
SynonymsMOR7-1, GA_x6K02T2PBJ9-5696486-5695545
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6810 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102981608-102989324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 102984835 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 110 (S110A)
Ref Sequence ENSEMBL: ENSMUSP00000149209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056235] [ENSMUST00000215606]
Predicted Effect probably damaging
Transcript: ENSMUST00000056235
AA Change: S110A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000058167
Gene: ENSMUSG00000045792
AA Change: S110A

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 5e-130 PFAM
Pfam:7TM_GPCR_Srsx 37 309 1.6e-7 PFAM
Pfam:7tm_1 43 294 3.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215606
AA Change: S110A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik C T 10: 22,066,717 G455R probably damaging Het
Adgrg5 A T 8: 94,933,942 T70S probably damaging Het
Adora1 T C 1: 134,234,039 Y106C probably damaging Het
Aox3 T A 1: 58,141,431 N250K probably benign Het
Ap2b1 A T 11: 83,335,491 Y238F possibly damaging Het
Birc6 G A 17: 74,612,220 S2015N possibly damaging Het
C7 A G 15: 5,007,654 F581L probably damaging Het
Cd27 A T 6: 125,233,664 H203Q probably damaging Het
Cdk2 A G 10: 128,699,587 V274A probably benign Het
Cenpe A G 3: 135,243,822 T1351A probably benign Het
Chd7 T C 4: 8,839,523 L1353P probably damaging Het
Dcc C T 18: 71,370,693 V945M probably damaging Het
Dio1 A G 4: 107,297,725 V118A probably damaging Het
Dst C T 1: 34,212,298 T1818M probably damaging Het
Dthd1 T A 5: 62,814,329 M165K probably benign Het
Eif5b A G 1: 38,046,660 I929V probably benign Het
F5 T A 1: 164,186,902 S581T probably damaging Het
Fanca A C 8: 123,286,477 I761S probably damaging Het
Fat2 T C 11: 55,282,241 T2549A possibly damaging Het
Fut2 A G 7: 45,650,505 L281P probably damaging Het
Gm19410 C A 8: 35,772,579 A143E probably damaging Het
Gm5431 T C 11: 48,888,976 D651G probably damaging Het
Hook3 A C 8: 26,032,422 probably null Het
Ivd G T 2: 118,869,761 V90L probably benign Het
Klhdc7b A G 15: 89,388,356 Y1147C possibly damaging Het
Mlh1 G A 9: 111,241,558 T363M possibly damaging Het
Ndufa3 A T 7: 3,619,477 I45F probably damaging Het
Nell2 T C 15: 95,241,587 D588G probably damaging Het
Nhlrc3 T C 3: 53,453,575 N253S probably benign Het
Nlrp4c T A 7: 6,066,755 F552I probably damaging Het
Olfr1052 G A 2: 86,297,923 A36T probably benign Het
Pcdhga12 T C 18: 37,767,179 S355P probably benign Het
Pcdhga7 A T 18: 37,715,873 Y311F probably benign Het
Phldb2 A G 16: 45,748,725 probably null Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Plxna4 A G 6: 32,310,522 V480A probably benign Het
Psrc1 A T 3: 108,385,348 K152N possibly damaging Het
Ptcd3 A C 6: 71,885,532 V473G probably damaging Het
Rab11fip1 ACTCT ACT 8: 27,152,732 probably null Het
Skint6 T C 4: 112,948,380 probably null Het
Slc24a1 A G 9: 64,948,323 V434A probably benign Het
Snd1 T A 6: 28,668,610 V432E probably benign Het
Syne2 C T 12: 75,942,885 T1847M probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tes C A 6: 17,104,652 N377K probably benign Het
Tfip11 T A 5: 112,333,597 I452N probably benign Het
Tgfbi T C 13: 56,637,203 S658P probably benign Het
Tmx4 A C 2: 134,620,674 D112E probably damaging Het
Tnn G T 1: 160,104,842 D1367E probably damaging Het
Triobp A G 15: 78,966,615 N323S possibly damaging Het
Usp40 T C 1: 87,981,033 D582G probably benign Het
Vmn2r99 A G 17: 19,380,034 K440R probably benign Het
Zfp707 T A 15: 75,974,899 L193Q probably damaging Het
Zfp748 T C 13: 67,541,725 Y472C probably damaging Het
Other mutations in Olfr578
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02580:Olfr578 APN 7 102984702 missense probably damaging 0.97
IGL02658:Olfr578 APN 7 102984330 missense probably benign 0.00
R0833:Olfr578 UTSW 7 102984836 missense possibly damaging 0.50
R1470:Olfr578 UTSW 7 102984323 nonsense probably null
R1470:Olfr578 UTSW 7 102984323 nonsense probably null
R2029:Olfr578 UTSW 7 102984271 missense probably damaging 0.99
R2249:Olfr578 UTSW 7 102984440 missense possibly damaging 0.74
R2413:Olfr578 UTSW 7 102984802 missense probably damaging 1.00
R2898:Olfr578 UTSW 7 102984877 missense probably benign 0.19
R4441:Olfr578 UTSW 7 102984309 missense possibly damaging 0.65
R5696:Olfr578 UTSW 7 102984541 missense probably benign 0.02
R7263:Olfr578 UTSW 7 102984317 nonsense probably null
R7366:Olfr578 UTSW 7 102984516 missense probably damaging 1.00
R7952:Olfr578 UTSW 7 102984514 missense probably benign 0.00
X0022:Olfr578 UTSW 7 102985026 missense probably benign 0.02
X0028:Olfr578 UTSW 7 102984343 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAGGCTAGTTTCATGATCTC -3'
(R):5'- GATGCCACTCTCCATGAACC -3'

Sequencing Primer
(F):5'- CAGGCTAGTTTCATGATCTCCAGATG -3'
(R):5'- CATGAACCTATGTACTATTTCTTGGC -3'
Posted On2018-09-12