Incidental Mutation 'R6810:Adgrg5'
ID533762
Institutional Source Beutler Lab
Gene Symbol Adgrg5
Ensembl Gene ENSMUSG00000061577
Gene Nameadhesion G protein-coupled receptor G5
SynonymsGpr114, PGR27, LOC382045
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6810 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location94923694-94943280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94933942 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 70 (T70S)
Ref Sequence ENSEMBL: ENSMUSP00000074155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074570] [ENSMUST00000128308] [ENSMUST00000153448] [ENSMUST00000166802]
Predicted Effect probably damaging
Transcript: ENSMUST00000074570
AA Change: T70S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074155
Gene: ENSMUSG00000061577
AA Change: T70S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 87 95 N/A INTRINSIC
GPS 181 234 4.7e-13 SMART
Pfam:7tm_2 240 494 2.1e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128308
AA Change: T66S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120217
Gene: ENSMUSG00000061577
AA Change: T66S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 83 91 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153448
SMART Domains Protein: ENSMUSP00000122780
Gene: ENSMUSG00000061577

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166802
AA Change: T70S

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132628
Gene: ENSMUSG00000061577
AA Change: T70S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 87 95 N/A INTRINSIC
GPS 181 234 1.37e-14 SMART
Pfam:7tm_2 241 495 1.3e-36 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adhesion family of G-protein coupled receptors. Members of this family are characterized by long N-termini and multiple functional domains. They may play a role in the immune system as well as in the central nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik C T 10: 22,066,717 G455R probably damaging Het
Adora1 T C 1: 134,234,039 Y106C probably damaging Het
Aox3 T A 1: 58,141,431 N250K probably benign Het
Ap2b1 A T 11: 83,335,491 Y238F possibly damaging Het
Birc6 G A 17: 74,612,220 S2015N possibly damaging Het
C7 A G 15: 5,007,654 F581L probably damaging Het
Cd27 A T 6: 125,233,664 H203Q probably damaging Het
Cdk2 A G 10: 128,699,587 V274A probably benign Het
Cenpe A G 3: 135,243,822 T1351A probably benign Het
Chd7 T C 4: 8,839,523 L1353P probably damaging Het
Dcc C T 18: 71,370,693 V945M probably damaging Het
Dio1 A G 4: 107,297,725 V118A probably damaging Het
Dst C T 1: 34,212,298 T1818M probably damaging Het
Dthd1 T A 5: 62,814,329 M165K probably benign Het
Eif5b A G 1: 38,046,660 I929V probably benign Het
F5 T A 1: 164,186,902 S581T probably damaging Het
Fanca A C 8: 123,286,477 I761S probably damaging Het
Fat2 T C 11: 55,282,241 T2549A possibly damaging Het
Fut2 A G 7: 45,650,505 L281P probably damaging Het
Gm19410 C A 8: 35,772,579 A143E probably damaging Het
Gm5431 T C 11: 48,888,976 D651G probably damaging Het
Hook3 A C 8: 26,032,422 probably null Het
Ivd G T 2: 118,869,761 V90L probably benign Het
Klhdc7b A G 15: 89,388,356 Y1147C possibly damaging Het
Mlh1 G A 9: 111,241,558 T363M possibly damaging Het
Ndufa3 A T 7: 3,619,477 I45F probably damaging Het
Nell2 T C 15: 95,241,587 D588G probably damaging Het
Nhlrc3 T C 3: 53,453,575 N253S probably benign Het
Nlrp4c T A 7: 6,066,755 F552I probably damaging Het
Olfr1052 G A 2: 86,297,923 A36T probably benign Het
Olfr578 A C 7: 102,984,835 S110A probably damaging Het
Pcdhga12 T C 18: 37,767,179 S355P probably benign Het
Pcdhga7 A T 18: 37,715,873 Y311F probably benign Het
Phldb2 A G 16: 45,748,725 probably null Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Plxna4 A G 6: 32,310,522 V480A probably benign Het
Psrc1 A T 3: 108,385,348 K152N possibly damaging Het
Ptcd3 A C 6: 71,885,532 V473G probably damaging Het
Rab11fip1 ACTCT ACT 8: 27,152,732 probably null Het
Skint6 T C 4: 112,948,380 probably null Het
Slc24a1 A G 9: 64,948,323 V434A probably benign Het
Snd1 T A 6: 28,668,610 V432E probably benign Het
Syne2 C T 12: 75,942,885 T1847M probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tes C A 6: 17,104,652 N377K probably benign Het
Tfip11 T A 5: 112,333,597 I452N probably benign Het
Tgfbi T C 13: 56,637,203 S658P probably benign Het
Tmx4 A C 2: 134,620,674 D112E probably damaging Het
Tnn G T 1: 160,104,842 D1367E probably damaging Het
Triobp A G 15: 78,966,615 N323S possibly damaging Het
Usp40 T C 1: 87,981,033 D582G probably benign Het
Vmn2r99 A G 17: 19,380,034 K440R probably benign Het
Zfp707 T A 15: 75,974,899 L193Q probably damaging Het
Zfp748 T C 13: 67,541,725 Y472C probably damaging Het
Other mutations in Adgrg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Adgrg5 APN 8 94937629 missense probably damaging 1.00
IGL02617:Adgrg5 APN 8 94933982 missense probably benign 0.01
R0483:Adgrg5 UTSW 8 94933508 missense possibly damaging 0.73
R0539:Adgrg5 UTSW 8 94938632 missense probably damaging 1.00
R0580:Adgrg5 UTSW 8 94937344 critical splice donor site probably null
R0650:Adgrg5 UTSW 8 94934157 critical splice donor site probably null
R0652:Adgrg5 UTSW 8 94934157 critical splice donor site probably null
R0828:Adgrg5 UTSW 8 94941785 splice site probably null
R1546:Adgrg5 UTSW 8 94941630 missense probably benign 0.27
R1567:Adgrg5 UTSW 8 94937698 missense probably damaging 0.97
R1695:Adgrg5 UTSW 8 94937745 missense probably damaging 1.00
R1753:Adgrg5 UTSW 8 94942052 missense possibly damaging 0.65
R1852:Adgrg5 UTSW 8 94937800 missense probably damaging 1.00
R2018:Adgrg5 UTSW 8 94934480 missense probably damaging 1.00
R2051:Adgrg5 UTSW 8 94942067 missense probably benign 0.01
R2190:Adgrg5 UTSW 8 94933951 missense probably damaging 1.00
R2299:Adgrg5 UTSW 8 94938576 missense possibly damaging 0.88
R2568:Adgrg5 UTSW 8 94934021 missense probably damaging 0.99
R4283:Adgrg5 UTSW 8 94937698 missense probably benign 0.21
R4512:Adgrg5 UTSW 8 94934024 missense possibly damaging 0.90
R4825:Adgrg5 UTSW 8 94941734 missense possibly damaging 0.77
R5422:Adgrg5 UTSW 8 94933952 missense probably damaging 1.00
R5427:Adgrg5 UTSW 8 94935102 missense probably benign 0.27
R6186:Adgrg5 UTSW 8 94934024 missense possibly damaging 0.90
R6522:Adgrg5 UTSW 8 94942068 missense probably benign 0.13
R6608:Adgrg5 UTSW 8 94941720 missense probably damaging 1.00
R6816:Adgrg5 UTSW 8 94941683 missense probably damaging 0.99
R7214:Adgrg5 UTSW 8 94934018 missense
R7686:Adgrg5 UTSW 8 94937802 missense
X0027:Adgrg5 UTSW 8 94937338 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TAGGCTCTAAGACTTGCGTGG -3'
(R):5'- GAGAGGCCATAGAGCACTTC -3'

Sequencing Primer
(F):5'- CTCTAAGACTTGCGTGGGGGAC -3'
(R):5'- GAGGCCATAGAGCACTTCCTCTTTC -3'
Posted On2018-09-12